ID: 1038645104

View in Genome Browser
Species Human (GRCh38)
Location 8:29354415-29354437
Sequence CAAGTCAGGACTGAAAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038645099_1038645104 -4 Left 1038645099 8:29354396-29354418 CCTACGTACCTCTGCCCATCAAG No data
Right 1038645104 8:29354415-29354437 CAAGTCAGGACTGAAAGCGAAGG No data
1038645097_1038645104 1 Left 1038645097 8:29354391-29354413 CCTTCCCTACGTACCTCTGCCCA No data
Right 1038645104 8:29354415-29354437 CAAGTCAGGACTGAAAGCGAAGG No data
1038645098_1038645104 -3 Left 1038645098 8:29354395-29354417 CCCTACGTACCTCTGCCCATCAA No data
Right 1038645104 8:29354415-29354437 CAAGTCAGGACTGAAAGCGAAGG No data
1038645096_1038645104 6 Left 1038645096 8:29354386-29354408 CCTGTCCTTCCCTACGTACCTCT No data
Right 1038645104 8:29354415-29354437 CAAGTCAGGACTGAAAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038645104 Original CRISPR CAAGTCAGGACTGAAAGCGA AGG Intergenic
No off target data available for this crispr