ID: 1038646248

View in Genome Browser
Species Human (GRCh38)
Location 8:29364934-29364956
Sequence CAGAGGATGGGGCAGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038646238_1038646248 9 Left 1038646238 8:29364902-29364924 CCATCCGCCAGAGGTACATGCCC No data
Right 1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG No data
1038646237_1038646248 12 Left 1038646237 8:29364899-29364921 CCTCCATCCGCCAGAGGTACATG No data
Right 1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG No data
1038646240_1038646248 2 Left 1038646240 8:29364909-29364931 CCAGAGGTACATGCCCCAAGACA No data
Right 1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG No data
1038646239_1038646248 5 Left 1038646239 8:29364906-29364928 CCGCCAGAGGTACATGCCCCAAG No data
Right 1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038646248 Original CRISPR CAGAGGATGGGGCAGAGATC TGG Intergenic
No off target data available for this crispr