ID: 1038649843

View in Genome Browser
Species Human (GRCh38)
Location 8:29392588-29392610
Sequence TAGAATCACCAACAATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038649843_1038649848 29 Left 1038649843 8:29392588-29392610 CCCTGCTATTGTTGGTGATTCTA No data
Right 1038649848 8:29392640-29392662 TGTTCTTTCTTAGTTCAGTTCGG No data
1038649843_1038649846 -4 Left 1038649843 8:29392588-29392610 CCCTGCTATTGTTGGTGATTCTA No data
Right 1038649846 8:29392607-29392629 TCTATTTAAATGGAAATGAATGG No data
1038649843_1038649847 -3 Left 1038649843 8:29392588-29392610 CCCTGCTATTGTTGGTGATTCTA No data
Right 1038649847 8:29392608-29392630 CTATTTAAATGGAAATGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038649843 Original CRISPR TAGAATCACCAACAATAGCA GGG (reversed) Intergenic
No off target data available for this crispr