ID: 1038649944

View in Genome Browser
Species Human (GRCh38)
Location 8:29393479-29393501
Sequence AGCAATCATCATAGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038649940_1038649944 6 Left 1038649940 8:29393450-29393472 CCAATTATGAATAAGACCTTGAA No data
Right 1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG No data
1038649939_1038649944 17 Left 1038649939 8:29393439-29393461 CCATTGATGAGCCAATTATGAAT No data
Right 1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG No data
1038649941_1038649944 -10 Left 1038649941 8:29393466-29393488 CCTTGAATTTCTAAGCAATCATC No data
Right 1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038649944 Original CRISPR AGCAATCATCATAGTGGGCA AGG Intergenic
No off target data available for this crispr