ID: 1038654352

View in Genome Browser
Species Human (GRCh38)
Location 8:29435667-29435689
Sequence CTGCCTGTGCCCAGATTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038654352_1038654356 13 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654356 8:29435703-29435725 TTCAATGGCCCAAGAGTATCAGG No data
1038654352_1038654354 -2 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654354 8:29435688-29435710 AGTGGTTACCGTTAGTTCAATGG No data
1038654352_1038654358 20 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654358 8:29435710-29435732 GCCCAAGAGTATCAGGGCTGAGG No data
1038654352_1038654357 14 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654357 8:29435704-29435726 TCAATGGCCCAAGAGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038654352 Original CRISPR CTGCCTGTGCCCAGATTTCA TGG (reversed) Intergenic
No off target data available for this crispr