ID: 1038654354

View in Genome Browser
Species Human (GRCh38)
Location 8:29435688-29435710
Sequence AGTGGTTACCGTTAGTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038654352_1038654354 -2 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654354 8:29435688-29435710 AGTGGTTACCGTTAGTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038654354 Original CRISPR AGTGGTTACCGTTAGTTCAA TGG Intergenic
No off target data available for this crispr