ID: 1038654356

View in Genome Browser
Species Human (GRCh38)
Location 8:29435703-29435725
Sequence TTCAATGGCCCAAGAGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038654352_1038654356 13 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654356 8:29435703-29435725 TTCAATGGCCCAAGAGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038654356 Original CRISPR TTCAATGGCCCAAGAGTATC AGG Intergenic
No off target data available for this crispr