ID: 1038654358

View in Genome Browser
Species Human (GRCh38)
Location 8:29435710-29435732
Sequence GCCCAAGAGTATCAGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038654355_1038654358 -9 Left 1038654355 8:29435696-29435718 CCGTTAGTTCAATGGCCCAAGAG No data
Right 1038654358 8:29435710-29435732 GCCCAAGAGTATCAGGGCTGAGG No data
1038654352_1038654358 20 Left 1038654352 8:29435667-29435689 CCATGAAATCTGGGCACAGGCAG No data
Right 1038654358 8:29435710-29435732 GCCCAAGAGTATCAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038654358 Original CRISPR GCCCAAGAGTATCAGGGCTG AGG Intergenic
No off target data available for this crispr