ID: 1038657330

View in Genome Browser
Species Human (GRCh38)
Location 8:29465761-29465783
Sequence CTGTAAATATAGATGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038657330_1038657336 29 Left 1038657330 8:29465761-29465783 CCAAGCTTCATCTATATTTACAG No data
Right 1038657336 8:29465813-29465835 AGCTCCGCCTCGTGTCAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038657330 Original CRISPR CTGTAAATATAGATGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr