ID: 1038666557

View in Genome Browser
Species Human (GRCh38)
Location 8:29542698-29542720
Sequence GCACTTATTAAATTTAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038666557_1038666562 9 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666557_1038666564 21 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666557_1038666563 18 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666557_1038666560 0 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038666557 Original CRISPR GCACTTATTAAATTTAGTGA GGG (reversed) Intergenic
No off target data available for this crispr