ID: 1038666560

View in Genome Browser
Species Human (GRCh38)
Location 8:29542721-29542743
Sequence TGGTATATCCAGTGCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 66, 1: 64, 2: 26, 3: 30, 4: 182}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038666557_1038666560 0 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666552_1038666560 20 Left 1038666552 8:29542678-29542700 CCATCACTAACCTACCCCTGCCC 0: 36
1: 72
2: 54
3: 72
4: 352
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666551_1038666560 27 Left 1038666551 8:29542671-29542693 CCTAAATCCATCACTAACCTACC No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666558_1038666560 -1 Left 1038666558 8:29542699-29542721 CCTCACTAAATTTAATAAGTGCT No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666550_1038666560 28 Left 1038666550 8:29542670-29542692 CCCTAAATCCATCACTAACCTAC No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666555_1038666560 5 Left 1038666555 8:29542693-29542715 CCCTGCCCTCACTAAATTTAATA No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666553_1038666560 10 Left 1038666553 8:29542688-29542710 CCTACCCCTGCCCTCACTAAATT No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666554_1038666560 6 Left 1038666554 8:29542692-29542714 CCCCTGCCCTCACTAAATTTAAT No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182
1038666556_1038666560 4 Left 1038666556 8:29542694-29542716 CCTGCCCTCACTAAATTTAATAA No data
Right 1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG 0: 66
1: 64
2: 26
3: 30
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038666560 Original CRISPR TGGTATATCCAGTGCATTGT TGG Intergenic
901357917 1:8667908-8667930 GGGGCTATCCTGTGCATTGTAGG + Intronic
901417112 1:9124974-9124996 TGGTATATCCAGTGCATTGTTGG + Intronic
901946176 1:12705940-12705962 TGGTATATCCAGTGCATTGTTGG + Intergenic
903969082 1:27107424-27107446 TGGTGTGTGTAGTGCATTGTAGG - Intronic
904137411 1:28324281-28324303 TGGTATATACTGTATATTGTAGG - Intergenic
906561047 1:46757219-46757241 TGGTATATCCAGTGCATTGGTGG + Intergenic
906822030 1:48939961-48939983 TGGTCTGTCCTGTGCATTGTAGG - Intronic
906898195 1:49802690-49802712 TGGTATATCCAGTGCATTGTTGG + Intronic
908023407 1:59922022-59922044 TGGTATATCCAGCGCACTGGCGG + Intronic
908208565 1:61876551-61876573 TGGGGTATCCTGTGCATTGTAGG + Intronic
909049564 1:70752307-70752329 TGGTATATCCAGTGCATTGGCGG + Intergenic
909881871 1:80889851-80889873 AGGTCTGTCCTGTGCATTGTAGG - Intergenic
910831607 1:91467116-91467138 TGGTATATCCAGTGCATTGTTGG + Intergenic
911027916 1:93454709-93454731 TAGTATTTCCAGTCCATGGTTGG - Intronic
911507130 1:98767110-98767132 TGATATATCCAGTGTATCATGGG - Intergenic
911755866 1:101556182-101556204 TGGTATACCCAGTGCTTTGGTGG + Intergenic
911848942 1:102789987-102790009 TGGTATATCTAGTGCATTGGCGG - Intergenic
911875744 1:103160793-103160815 TGGTTTATTCTGTGCATTGCAGG - Intergenic
913537426 1:119786365-119786387 TGGTATATCCAGTGTATTGTTGG - Intergenic
913750045 1:121953540-121953562 TGGAATATGCAGTGGATTTTGGG - Intergenic
914393383 1:147242117-147242139 GGGTATCTCAAGTGCATTATGGG - Intronic
916449978 1:164911404-164911426 AGGGCTATCCCGTGCATTGTAGG + Intergenic
917042769 1:170824376-170824398 GGGGATATCCCGTGCATGGTAGG - Intergenic
917612814 1:176706129-176706151 TGGCATGTCCAGTGGGTTGTGGG - Intronic
917766316 1:178221762-178221784 AGGTATATTCAGTGAATTGCCGG + Intronic
918157740 1:181866234-181866256 TTCTTTATCCAGTCCATTGTTGG - Intergenic
919318323 1:196002172-196002194 TGGTATATCCAGTGCATCGTTGG - Intergenic
921359136 1:214314206-214314228 TGTTTTATCCAGTGCATCTTTGG + Intronic
921975350 1:221196710-221196732 TCGTATATCCAGTGCATTGTTGG - Intergenic
922189372 1:223303686-223303708 TGGCATATCCAGTACATTGGCGG - Intronic
923177302 1:231479137-231479159 TGGTATATCCACTGCTTTTCTGG - Intergenic
924276735 1:242396230-242396252 GGGACTATCCTGTGCATTGTAGG + Intronic
924283322 1:242460277-242460299 TGGTATATCCAGTGCATTGTTGG + Intronic
924950874 1:248882195-248882217 TGGTATATCCCGTGCATTTTTGG - Intergenic
1064298713 10:14102564-14102586 TGAGATAACCACTGCATTGTGGG - Intronic
1065371692 10:24993380-24993402 TGATAAATCCAATGGATTGTTGG + Intronic
1066592253 10:37008116-37008138 TGGTATATCCAGTGCATTGTTGG - Intergenic
1067316829 10:45175537-45175559 TGGTATATCCAGTGCATTGGCGG - Intergenic
1067958960 10:50825988-50826010 GGGTCTGTCCAGTGGATTGTAGG - Intronic
1068020770 10:51581039-51581061 TGGTATATCCAGTGCATTGGAGG - Intronic
1068180968 10:53518289-53518311 TGGTATATCCAGTGCATTGTTGG + Intergenic
1068209908 10:53908033-53908055 TTGAAAATCCAGTGCAGTGTAGG - Intronic
1072005483 10:91242213-91242235 GGGCCTATCCTGTGCATTGTAGG - Intronic
1072175071 10:92912428-92912450 TGGTATATCCAGTGCATTGGAGG - Intronic
1072248360 10:93562618-93562640 GGGAATGTCCTGTGCATTGTAGG + Intergenic
1072386833 10:94939306-94939328 TGGTATATCCAGTGCATTCTTGG - Intronic
1073515015 10:104068549-104068571 TAGTATATACAGTGCCTTCTTGG - Intronic
1074186161 10:111101030-111101052 TGGTAGTTCCAGTTCATTGCAGG + Intergenic
1075476085 10:122735186-122735208 TGGACTGTCCTGTGCATTGTAGG + Intergenic
1075776400 10:124991701-124991723 TGGCCTGTCCTGTGCATTGTAGG - Intronic
1075820849 10:125308460-125308482 TGGTATTTTCAGTGAATAGTTGG - Intergenic
1079911514 11:26316263-26316285 TGGTATATCCAGTGCATTGGTGG - Intronic
1080107252 11:28523972-28523994 GGATCTATCCTGTGCATTGTGGG - Intergenic
1080959030 11:37136151-37136173 TGGTATATCTAGTGCATTGTTGG + Intergenic
1081084721 11:38785685-38785707 TGGTATATCCAGTGCATTGTTGG + Intergenic
1081522194 11:43893235-43893257 GGGTCTATCCCTTGCATTGTAGG + Intronic
1084221354 11:67681931-67681953 TGGTATATCCAGTGCATTGTTGG - Intergenic
1086210892 11:84317274-84317296 TGCTATAAGCAGTGCATCGTGGG + Intronic
1086957024 11:92943714-92943736 TGGCATATCCAGTGCATCGTTGG - Intergenic
1086957577 11:92949378-92949400 GGACATAACCAGTGCATTGTTGG - Intergenic
1087579347 11:100031897-100031919 TGGTATATCCAGTGCATTGGTGG + Intronic
1087646402 11:100813221-100813243 GGGTCTGTCCTGTGCATTGTAGG + Intronic
1088408795 11:109510635-109510657 GAGTCTGTCCAGTGCATTGTAGG - Intergenic
1089951572 11:122532981-122533003 TGTTTTATCCAGTGCCTTGATGG + Intergenic
1095092903 12:38123546-38123568 TGGTATATCCAGTTCATTGGTGG + Intergenic
1096934523 12:55256693-55256715 TGGTATATCCAGTGCATTAGTGG + Intergenic
1098422326 12:70313517-70313539 TGGTTTAACCTGTGAATTGTAGG + Intronic
1098747671 12:74260705-74260727 TGGTATATCCAGTGCATTGTTGG + Intergenic
1099810706 12:87578947-87578969 TGGTATATACAGTGCATTGGTGG - Intergenic
1100184425 12:92123782-92123804 TTGTATACACAGTTCATTGTTGG + Intronic
1102326993 12:111994469-111994491 CAGTATATCCAGTGCATTGGCGG - Intronic
1103068122 12:117917020-117917042 TGGGCCATTCAGTGCATTGTAGG + Intronic
1103173275 12:118840641-118840663 TGTGTTATCCTGTGCATTGTAGG - Intergenic
1104089116 12:125500029-125500051 TGGTATATCCAGTGCATTGTTGG + Intronic
1104139621 12:125974863-125974885 TGGTATATCCAGTGCATTGTTGG + Intergenic
1104222733 12:126801063-126801085 TGGTAAAACCAGTGAGTTGTGGG - Intergenic
1105583186 13:21720303-21720325 TTGTATATCCAGCTCCTTGTTGG + Intergenic
1105886476 13:24646979-24647001 TGGTATATCCAGTGCATTGGCGG + Intergenic
1107644989 13:42484783-42484805 TGGGCCATCCTGTGCATTGTAGG + Intergenic
1107879939 13:44824152-44824174 GGGTCTGTCCTGTGCATTGTAGG + Intergenic
1109105245 13:58241807-58241829 TGGTATATCCAGCGCATTTGTGG + Intergenic
1109298411 13:60563543-60563565 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1109447458 13:62461036-62461058 TGGATTATGAAGTGCATTGTAGG + Intergenic
1110206279 13:72918230-72918252 AGGTATATCCACTGCACTTTGGG - Intronic
1110476655 13:75923049-75923071 TGGTATATGCAGTGATTTCTTGG + Intergenic
1112028047 13:95430442-95430464 TGGTATATCCAGTGCATTGTTGG - Intergenic
1112456585 13:99568661-99568683 TGGTAAATCCAGTGCATTGGCGG - Intergenic
1112642701 13:101294631-101294653 TGGTATATCCAGTACGTTGGCGG - Intronic
1114599674 14:23944216-23944238 TGGTATATCCAGTGCGTTGTTGG - Intergenic
1114786745 14:25609010-25609032 TGGAATAAAGAGTGCATTGTAGG + Intergenic
1116646061 14:47530612-47530634 CGGTATACCAAGTGCATTGGCGG + Intronic
1116761900 14:49025269-49025291 TGGTATATCCAATACAATGCCGG - Intergenic
1117986260 14:61389002-61389024 GGGTAAGTCCAGTGCATTTTTGG + Intronic
1119773017 14:77233197-77233219 TGGTATCTCCAGGGCATAATTGG - Intronic
1120268974 14:82286282-82286304 TGGTATATCCAGTGCATTGGCGG + Intergenic
1120597348 14:86457400-86457422 TGAGCTATCCTGTGCATTGTAGG - Intergenic
1120757512 14:88257910-88257932 GGGTCTATGCTGTGCATTGTAGG + Intronic
1121420453 14:93809389-93809411 TGGCATATACAGTGCATTGGCGG - Intergenic
1121758364 14:96422063-96422085 TGGTATATCCAGTGCATTGTTGG - Intronic
1123208137 14:106733556-106733578 TGGTATATCCAGTGCATTGTTGG + Intergenic
1123931376 15:25173302-25173324 TGCTATTTCCAGTGCATGCTTGG + Intergenic
1124984271 15:34590880-34590902 GGGGCTATCCTGTGCATTGTAGG + Intergenic
1127005343 15:54562848-54562870 TGGTATATTAAGTTCATTCTTGG - Intronic
1128914359 15:71546405-71546427 GTGTATCTCAAGTGCATTGTAGG + Intronic
1129567729 15:76641424-76641446 TGGTATATCCAGTGCATTGTTGG + Intronic
1129820168 15:78595590-78595612 GGGGGTATCCTGTGCATTGTAGG - Exonic
1132439520 15:101845334-101845356 GGGTCTATCCTGTGCAGTGTAGG + Intergenic
1133537175 16:6713467-6713489 GGGTCTGTCCTGTGCATTGTAGG + Intronic
1133622613 16:7540956-7540978 TGGTTAATTCAGTGCATTGAAGG + Intronic
1134864571 16:17593244-17593266 GGGTCTGTCCTGTGCATTGTAGG - Intergenic
1135160510 16:20091031-20091053 GGGTGTGTCCTGTGCATTGTAGG - Intergenic
1136871836 16:33814408-33814430 TGGTACATCCAGTGCATTGTTGG + Intergenic
1139285905 16:65813886-65813908 TGGTATACCCAGTGCATTGTTGG + Intergenic
1139975223 16:70804652-70804674 TGTTATCTCCAGAGCATTGAGGG + Intergenic
1140299994 16:73748056-73748078 TAGTCTATCCAGTGGGTTGTAGG + Intergenic
1203100336 16_KI270728v1_random:1301660-1301682 TGGTACATCCAGTGCATTGTTGG - Intergenic
1143470260 17:7169587-7169609 TGGTATATCCAGTGCATTGGCGG + Intergenic
1145730611 17:27181368-27181390 TGGTATATCCAGTGCATTGTTGG - Intergenic
1146747162 17:35342085-35342107 TGCTATATCCAGTGCATTCGTGG + Intergenic
1147539101 17:41341970-41341992 ATTTATATCCAGTGCATTGGTGG - Intergenic
1149165619 17:53748771-53748793 TGGTATACCCAGTGCATTGGCGG + Intergenic
1150453799 17:65291012-65291034 GGGTCTGTCCTGTGCATTGTAGG + Intergenic
1151397254 17:73831710-73831732 TGCTGTACCCAGTGCATTGACGG + Intergenic
1152061852 17:78082218-78082240 CGGTATATCCAGTGCATTGGTGG - Intronic
1153159849 18:2191709-2191731 AGTTATGTCCAGTGCATAGTAGG + Intergenic
1154478849 18:14796767-14796789 GGGTATATCCAGTGAATTGTTGG - Intronic
1154478999 18:14798203-14798225 GGGTATATCCAGTGAATTGTTGG - Intronic
1154479799 18:14809094-14809116 GGGTATATCTAGTGAATTGTTGG - Intronic
1155007870 18:21745332-21745354 AGGAATGTCCTGTGCATTGTAGG + Intronic
1156320091 18:36012113-36012135 TTGTATATGCAGTCCATTGTTGG - Intronic
1156670753 18:39466293-39466315 TGGCATATTCAAAGCATTGTAGG - Intergenic
1156758251 18:40555112-40555134 TAGGCTATCCTGTGCATTGTAGG + Intergenic
1158730603 18:60018400-60018422 TGGTCTGTCCTGTGCCTTGTGGG + Intergenic
1159118770 18:64145402-64145424 TGGTATATCCAGTGCATTGTTGG + Intergenic
1161540614 19:4848894-4848916 TAGTATATGCAGTCCATTGTTGG - Intronic
1161938046 19:7384199-7384221 GGGGCTATCCTGTGCATTGTAGG + Intronic
1162288998 19:9764586-9764608 TGGTATATCCAGTGCATTGTTGG + Intronic
1162740389 19:12770618-12770640 TGGGATCTGCAGAGCATTGTAGG + Intronic
1163076745 19:14899344-14899366 TGGGCTGTCCTGTGCATTGTAGG - Intergenic
1165566814 19:36736729-36736751 TGGTATATCCAGTGCATTGTTGG + Intronic
1167482731 19:49743043-49743065 TCATATTTCCAGTGCATTGTGGG - Intronic
1168432672 19:56293823-56293845 TGGGGTGTCCTGTGCATTGTAGG - Intronic
1168486605 19:56767900-56767922 TGGACCATCCAGTGCATTGTAGG - Intergenic
928627512 2:33155531-33155553 GGGTTTGTCCTGTGCATTGTAGG + Intronic
930697229 2:54424242-54424264 TGATATAACCAGTCTATTGTTGG - Intergenic
931392904 2:61860011-61860033 TGGGAGATCCTGTGCTTTGTGGG - Intergenic
931525727 2:63150427-63150449 TGGGCTGTCCTGTGCATTGTAGG - Intronic
931602126 2:64015544-64015566 AAGTATGTCCTGTGCATTGTAGG + Intronic
933822367 2:86125179-86125201 GGGTCTGTCCTGTGCATTGTAGG + Intronic
935248309 2:101238539-101238561 TGGTATATCCAGTGCATTGGCGG + Intronic
935248969 2:101244933-101244955 TGGTATATCCAGTGCATTGACGG + Intronic
936779508 2:116015260-116015282 TGGTATGTCCTGGGCATTCTAGG - Intergenic
936802963 2:116288904-116288926 TGGTATATCCAGTGCATTGTTGG + Intergenic
937552588 2:123112866-123112888 TGGTATATCCAGTGCATTGGTGG - Intergenic
939268928 2:139912787-139912809 TGGTATATCCAGTGCATTGTTGG - Intergenic
939403049 2:141719632-141719654 TTCTTTATCCAATGCATTGTTGG - Intronic
939646865 2:144710644-144710666 TGGGATTTTCAGTGCATTGACGG + Intergenic
939729808 2:145768837-145768859 TGGGCTGTCCTGTGCATTGTAGG - Intergenic
939735513 2:145839738-145839760 TGGCATGTACAGAGCATTGTGGG - Intergenic
941894538 2:170615804-170615826 TGGTATATCCAGTGCATTGTTGG - Intronic
941894822 2:170618675-170618697 TGGTATATCCAGAGCATTGTTGG - Intronic
943232777 2:185276478-185276500 TGGTGTATCCAGTGCATTGGCGG + Intergenic
943314975 2:186375866-186375888 TGGTATATCCAGTGCATTGTTGG + Intergenic
944140119 2:196447185-196447207 TGGAAAATACAGTGCTTTGTAGG - Intronic
944322005 2:198357048-198357070 GGGGGTATCCTGTGCATTGTAGG + Intronic
944970103 2:204983154-204983176 TGGTATAGCCAATGCAGTTTGGG + Intronic
945325934 2:208482362-208482384 TGGTATATCCAGTGCATTGTTGG - Intronic
945488888 2:210431019-210431041 TGGTATATCCAGCGCATTGTTGG + Intergenic
947303311 2:228714733-228714755 TGGTATATCCAGTGCATTGGCGG - Intergenic
1169155599 20:3327231-3327253 GGGTTTGTCCTGTGCATTGTAGG + Intronic
1171091368 20:22288525-22288547 TGGGGAATCCATTGCATTGTGGG + Intergenic
1173153186 20:40585251-40585273 TGGAGTATCCTGTGCTTTGTAGG + Intergenic
1174361511 20:50031711-50031733 GGGTATCTGCAGTGTATTGTGGG + Intergenic
1174674805 20:52343382-52343404 TGGGCTTTCCTGTGCATTGTAGG + Intergenic
1174892454 20:54411091-54411113 TAGAACATCCAGTGCAATGTGGG - Intergenic
1175236083 20:57512884-57512906 TGGGCTATCCTGTGCATTGTAGG + Intronic
1175613327 20:60370493-60370515 GGGTCAGTCCAGTGCATTGTAGG - Intergenic
1176800740 21:13427208-13427230 GGGTATATCCAGTGAATTGTTGG + Intergenic
1178155719 21:29851539-29851561 TGGCATTTCCACTGCATTATAGG - Intronic
1179071018 21:38071139-38071161 GGGTATGCCCTGTGCATTGTAGG + Intronic
1180321286 22:11323717-11323739 TGGTATAAACAGTGCATTACGGG - Intergenic
1181181582 22:21072423-21072445 TGGTATATCCAGTGCATTGTTGG + Intergenic
1182659300 22:31914007-31914029 AGGTCTATCCTGAGCATTGTAGG - Intergenic
1182910331 22:33978909-33978931 TGATATATCCAGTGCATCGGCGG + Intergenic
1184127494 22:42498428-42498450 TGGTATATCCCGTGCATTGTTGG - Intergenic
949663304 3:6307080-6307102 TGGTACATCCTGTGCATTGGCGG - Intergenic
951294880 3:20921573-20921595 TGGTATATCCAGTGCATTGTTGG - Intergenic
951595149 3:24310791-24310813 GGGAATGTCCTGTGCATTGTAGG - Intronic
952399412 3:32949719-32949741 TGGGCTGTCCTGTGCATTGTAGG + Intergenic
952608092 3:35173786-35173808 TAATATATCCAGTGCATTGATGG + Intergenic
952675385 3:36023751-36023773 TTGTATATGCAGTCCATTATGGG - Intergenic
953039838 3:39246035-39246057 GGGTATTTCCATTGTATTGTTGG + Intergenic
955034036 3:55248945-55248967 TGGTATATTCAGTGCGTTAGTGG - Intergenic
955737623 3:62056578-62056600 TGTTATGTCATGTGCATTGTAGG + Intronic
956813341 3:72886244-72886266 TGGTATGTCCTGAGCATTGCAGG + Intergenic
957175827 3:76808218-76808240 TGTTATTTGCAGTGCATCGTTGG - Intronic
957844409 3:85713467-85713489 TGATAAAGCCAGTGCTTTGTAGG - Intronic
958844994 3:99255606-99255628 TGGAATAAGCTGTGCATTGTTGG - Intergenic
959261761 3:104090916-104090938 TGGTATATCCAGTGCATTATTGG + Intergenic
959439756 3:106360784-106360806 TGGTATATCCAGTGCATTGGCGG - Intergenic
961472866 3:127127599-127127621 GGGGCTGTCCAGTGCATTGTAGG + Intergenic
962165896 3:133047545-133047567 TGGAGTGTCCTGTGCATTGTAGG + Intronic
963166311 3:142207677-142207699 TGGTATATCCAGTGCATTGTTGG + Intronic
964004039 3:151808764-151808786 TGGTATATCCAGTGCATTGTTGG - Intergenic
964156799 3:153595434-153595456 GGGGCTGTCCAGTGCATTGTAGG - Intergenic
965192415 3:165548729-165548751 TGGCATATCCAGTGCATTGGTGG + Intergenic
966830198 3:184001615-184001637 GGGGCTATCCTGTGCATTGTAGG - Intronic
967590451 3:191267606-191267628 TGGTATATCCAGTGCATTGTTGG - Exonic
970210834 4:13708407-13708429 TAGTATATCCAGCACATAGTAGG - Intergenic
970387681 4:15572587-15572609 AGGTCTGTCCTGTGCATTGTAGG - Intronic
970680955 4:18507261-18507283 TGGGACATCCACTGAATTGTGGG + Intergenic
972435863 4:39034947-39034969 CGGGATATCCTGTACATTGTAGG + Intergenic
972869969 4:43285906-43285928 TTGTATATCCAGAGCATTTTGGG + Intergenic
973794380 4:54409135-54409157 TGGTATATCCAGTGTATTGCTGG - Intergenic
974213826 4:58818511-58818533 TGGTATATCCAGTGTATTGTTGG + Intergenic
974304943 4:60124011-60124033 TGGTATAGCAATTGCATTGCTGG + Intergenic
975619514 4:76281907-76281929 TGGTATATCCAGTGCATTGTTGG - Intronic
975936872 4:79592063-79592085 TAGTATATCCAGTGCATTGTTGG - Intergenic
976485704 4:85601483-85601505 TGGTGTGTCCTGTGCGTTGTAGG + Intronic
976636450 4:87291154-87291176 TGGTACATCCAGTGCATTGTTGG - Intergenic
976953673 4:90866866-90866888 TTGTATATCCAGTTCACAGTAGG + Intronic
977058076 4:92218459-92218481 TGGTATATCCAGTGCATTGGTGG + Intergenic
977350700 4:95882342-95882364 TGGTATGTCCAATGCATTTTAGG + Intergenic
977360482 4:95998264-95998286 AGAATTATCCAGTGCATTGTAGG - Intergenic
977555057 4:98480003-98480025 TGGTATATCCAGTGCATTGTTGG + Intronic
977630033 4:99232317-99232339 TGGTATATCCAGTGCATTGTTGG + Intergenic
978544781 4:109859214-109859236 TGGTATATCTAGTGCATTGGTGG - Intronic
979358508 4:119733545-119733567 GGGTAAATCCAGTTCATTGCAGG + Intergenic
979734165 4:124062106-124062128 TGGTGTATTAAGTGCATTTTTGG - Intergenic
980306616 4:131068572-131068594 TGTCATATCCAGTAAATTGTTGG - Intergenic
980661440 4:135864099-135864121 TGGTATATCCAGTGCATTGTTGG - Intergenic
981150285 4:141372324-141372346 TTGTTTATCCAGTCCACTGTTGG + Intergenic
986633474 5:9797290-9797312 GGGGCTATCCTGTGCATTGTAGG - Intergenic
986890202 5:12294680-12294702 TGGTATATCCAGTGCATCGTTGG + Intergenic
987609244 5:20180692-20180714 TGGTATATCCAGTGCATTGTTGG + Intronic
988448646 5:31317151-31317173 TAGGATGTCCTGTGCATTGTAGG - Intronic
988769855 5:34421508-34421530 TGGTATATCCAGTGCATTGTTGG - Intergenic
988774073 5:34461082-34461104 TGGTATATCCAGTGCATTGGCGG - Intergenic
988774772 5:34467793-34467815 TGGTATATCCAGTGCATTGGCGG - Intergenic
989482305 5:41946108-41946130 TGGCATATCCAGTGCATTGTTGG + Intergenic
989559438 5:42834415-42834437 TGGTATATCCAGTGCATTGGCGG - Intronic
989570099 5:42938104-42938126 TGGTATATCCAGTGCATTGGTGG + Intergenic
990217589 5:53551521-53551543 TAGTATGTCCAGGGCATGGTAGG + Intergenic
990257549 5:53986899-53986921 AGGAATATCCAGTACAATGTTGG + Intronic
992007962 5:72497593-72497615 TGGCAGATACATTGCATTGTAGG + Intronic
992818687 5:80471557-80471579 TGGTATATCCAGTGCATCGTTGG + Intronic
994989065 5:106975674-106975696 TAGTATATCCAGTGTTTTTTGGG - Intergenic
995484559 5:112627238-112627260 GGGGATGTCCTGTGCATTGTAGG + Intergenic
995530151 5:113084407-113084429 GGGTCTGTCCTGTGCATTGTAGG + Intronic
995632531 5:114149498-114149520 TGGTATATCCAGTGCATTGGCGG - Intergenic
996474827 5:123904881-123904903 TGGTTAATCCAGTGGATGGTAGG - Intergenic
998761993 5:145442555-145442577 TGGTATATCCAGTGCACTGTTGG - Intergenic
999122373 5:149219150-149219172 TGGGCTGTCCTGTGCATTGTAGG + Intronic
999521835 5:152358887-152358909 TGGTATATACAGTGCATTGTTGG + Intergenic
999682503 5:154073137-154073159 TGGTATATCCAGTGCATTGGTGG - Intronic
1000514499 5:162223576-162223598 TTGTATATACAGCGTATTGTTGG + Intergenic
1000708753 5:164544767-164544789 TGGCATATCCAGTGCATTGGTGG + Intergenic
1002114253 5:176946110-176946132 TGGTATATTCAGTGCATTGTTGG + Intronic
1003108479 6:3233407-3233429 TGGTATATGCAGTCCATTCCAGG + Intronic
1003444182 6:6169729-6169751 GGGACTATCCTGTGCATTGTAGG - Intronic
1004806343 6:19207230-19207252 TGCTTTATCCAATCCATTGTTGG - Intergenic
1005852776 6:29834735-29834757 TGGTCTGTCCTGTGCATTGTGGG - Intergenic
1005876380 6:30013239-30013261 TGGTCTGTCCTGTGCATTGTGGG - Intergenic
1007694246 6:43721975-43721997 AGGTCTATCCTGGGCATTGTAGG + Intergenic
1008272023 6:49501397-49501419 TGGTATAGTCAGTGCATTGGCGG - Intronic
1008272650 6:49507828-49507850 TGGTATATTCAGTGCATTGGTGG - Intronic
1009592447 6:65689953-65689975 TGGTATATCCAGTGCATTGTTGG - Intronic
1009651546 6:66482504-66482526 TGGTATATCCAGTGCATTGTTGG - Intergenic
1010044842 6:71429400-71429422 AGGGCTGTCCAGTGCATTGTAGG - Intergenic
1010902168 6:81441449-81441471 TGGTATATCCAGTGCATGGTTGG + Intergenic
1011262780 6:85486029-85486051 TGGTATATCCAGTGCATTGTTGG - Intronic
1011835833 6:91430680-91430702 TGGTACATCCAGTGCTTTAAGGG + Intergenic
1013158551 6:107519302-107519324 TGGGCTGTCCTGTGCATTGTAGG - Intronic
1013158731 6:107520988-107521010 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1014246530 6:119076176-119076198 TGGGATATCCTGTGCATTATAGG - Intronic
1014405195 6:121042783-121042805 TGATATATACAGTGCATTGGCGG + Intergenic
1014405833 6:121049181-121049203 TGGTATATACAGTGCATTGGCGG + Intergenic
1015687291 6:135879154-135879176 TGGTATATCCAATTCATGGGAGG - Intronic
1016538279 6:145133823-145133845 TAGTATATCCAGTGCATTGGCGG + Intergenic
1017801542 6:157900551-157900573 TGGTATATCCAGTGCATTGTTGG - Intronic
1018763972 6:166915274-166915296 TGGTATATCCAGTGCATTGTTGG - Intronic
1019693137 7:2428532-2428554 TGGTATATCCAGTGCATTGGCGG - Intronic
1022450475 7:30509179-30509201 TGGTATATCCAGTGCATTGGCGG - Intronic
1022771276 7:33475510-33475532 GGGGCTATCCTGTGCATTGTAGG + Intronic
1023191127 7:37584254-37584276 TGGTATATCCAGTGCATTGGCGG - Intergenic
1025735612 7:64144089-64144111 TGGCATATCCAGTGCATTGTTGG - Intronic
1027491522 7:78833372-78833394 TGGTATATCCAGTGCATTGGAGG + Intronic
1028180357 7:87714302-87714324 TGGTATATCCAGTGCATTGTTGG - Intronic
1028181750 7:87732671-87732693 TGGTATATCTAGTGCATTGTTGG - Intronic
1028237959 7:88383769-88383791 TGCTATATCAAGGGCAGTGTTGG - Intergenic
1028246002 7:88477911-88477933 TGATATATGCAGTGCCTTGGAGG - Intergenic
1028327507 7:89545268-89545290 TGGTATATCCAGTGCATTGGCGG - Intergenic
1028707741 7:93870008-93870030 TGGTATATCCAGTGCATTGTTGG - Intronic
1029043128 7:97598452-97598474 TGGTACATCCAGTGCATTGTTGG + Intergenic
1032298107 7:130660842-130660864 TGGTAGAACCAGTGGATTGTAGG - Intronic
1032974447 7:137206293-137206315 TGGTATATCCAGTGCATTGTTGG + Intergenic
1033502188 7:141963086-141963108 TAGTATATCCAGTGCATTGCTGG + Intronic
1034716210 7:153244822-153244844 TGGTATATCCAGTACATTGTTGG - Intergenic
1034777509 7:153843540-153843562 TGGTATATCCAGTGCATTGGTGG - Intergenic
1036083942 8:5592132-5592154 TGGTATATCCAGTGCATTGGTGG + Intergenic
1036129631 8:6097059-6097081 TTGTCTTTCCCGTGCATTGTTGG - Intergenic
1037005004 8:13767459-13767481 TGGTATATCCAGTACATTGGTGG - Intergenic
1038666560 8:29542721-29542743 TGGTATATCCAGTGCATTGTTGG + Intergenic
1039672555 8:39618284-39618306 TGGTATATCGAATGCATTGTTGG - Intronic
1040277242 8:46020306-46020328 TGATATATCCAGTGCTTTGGTGG + Intergenic
1041066815 8:54090608-54090630 TGGTATATCCAGTGCATTGTTGG + Intronic
1041168617 8:55117045-55117067 TGGTATATCCAAAACATTATTGG - Intronic
1041296354 8:56361274-56361296 TGGTATATTCAGTGCATTGTTGG + Intergenic
1041599586 8:59700840-59700862 TTCTATATCCATTTCATTGTTGG - Intergenic
1043234419 8:77844087-77844109 TGGTATATGAAGTGCATCATGGG - Intergenic
1046416082 8:113915350-113915372 TGAGATATCAAGTGCACTGTTGG - Intergenic
1047451169 8:124966298-124966320 TGGTATATCCAGTGCATTGTTGG + Intergenic
1048422262 8:134288844-134288866 TGGTATATCCAGTGCATTGTTGG + Intergenic
1048431944 8:134378648-134378670 TGGTATATCCAGTGCATTGTTGG - Intergenic
1050198168 9:3110468-3110490 TGATATATCCAGTGCATTGTTGG - Intergenic
1052421991 9:28254299-28254321 TGCTATTTCCACTGTATTGTTGG + Intronic
1053517939 9:38747429-38747451 TGGGAGGTCCTGTGCATTGTAGG + Intergenic
1055608701 9:77998375-77998397 TGGTTTATGCAGTTCATTTTTGG - Intronic
1056710076 9:88985272-88985294 TGTTATCTACAGTGCATTCTCGG - Intergenic
1057988409 9:99741700-99741722 TGGACTGTCCTGTGCATTGTAGG - Intergenic
1058382627 9:104394665-104394687 TGGTATATCCAGTGCATTGTTGG - Intergenic
1059114905 9:111592491-111592513 GGGTATATTCAGTGCTTTGGTGG + Intronic
1059832775 9:118116989-118117011 TGGTATATCCAGTGCATTGGCGG - Intergenic
1060345190 9:122809778-122809800 TGGTATATCCAGTGCATTGTTGG + Intronic
1060435238 9:123587094-123587116 TGGTATATCCAGTGCATTGTTGG - Intronic
1061655792 9:132089067-132089089 TGGTATCACCAGTCCATTATTGG + Intergenic
1061740028 9:132695813-132695835 TGCTATTTCTAGTGCATTCTTGG + Intergenic
1186120437 X:6355363-6355385 TGGTATATCCAGTGCATTGTTGG - Intergenic
1186140529 X:6567235-6567257 TGGTATATCCAGTGCATGGTTGG - Intergenic
1186296479 X:8154517-8154539 TGGTATATCCAGTGCATTGTTGG + Intergenic
1186497863 X:10026157-10026179 GGGTCGATCCTGTGCATTGTAGG - Intronic
1186578834 X:10795056-10795078 TGGGCTGTCCTGTGCATTGTAGG + Intronic
1186715511 X:12247147-12247169 AGGGCTATCCTGTGCATTGTAGG + Intronic
1186971408 X:14848863-14848885 TGGTATATCCAGTGCATTGTTGG + Intronic
1188233242 X:27692862-27692884 GGGACTATCCAGTGCACTGTAGG - Intronic
1188536895 X:31206860-31206882 TTGAATTTCCATTGCATTGTAGG - Intronic
1188975032 X:36662755-36662777 TGGTATATCCAGTGCATTGGTGG + Intergenic
1189017286 X:37297341-37297363 TGGTATATCCAGTGCATTGTTGG - Intergenic
1189108237 X:38258751-38258773 AGGGTTATCCTGTGCATTGTAGG + Intronic
1189123278 X:38418101-38418123 GGGGATCTCCTGTGCATTGTTGG - Intronic
1189637626 X:43028183-43028205 TGGTATATCCAGTGCATTGTTGG - Intergenic
1191269484 X:58445013-58445035 TGGTGTATCCAGTGCATTGTTGG - Intergenic
1191576948 X:62716399-62716421 TGGTATATCCAGTGAATTGGTGG - Intergenic
1192889066 X:75368770-75368792 TGGTATATTGAATTCATTGTTGG + Exonic
1193023839 X:76822299-76822321 TGGTATATCCAGTGCATTGTTGG - Intergenic
1193442591 X:81561387-81561409 TGGTATATGCAATGCATTGGTGG + Intergenic
1193565492 X:83071134-83071156 TGGTATATCCAGTGCATTGTTGG + Intergenic
1193786225 X:85762422-85762444 TGCTATATACAATTCATTGTAGG + Intergenic
1194192503 X:90855194-90855216 TGGTATATCCAGTGCATTGTTGG + Intergenic
1194571071 X:95555128-95555150 TGGAATGACCAGTGCATTGGAGG + Intergenic
1194585779 X:95732442-95732464 GGGCATATCCTGTTCATTGTAGG + Intergenic
1195380374 X:104264926-104264948 GGGGATGTCCTGTGCATTGTGGG - Intergenic
1195506703 X:105666333-105666355 TGGTATATTCAGTGCATTGTTGG - Intronic
1195996613 X:110737993-110738015 TCGTCTATCCTGTGCATTGTGGG - Intronic
1196089538 X:111725225-111725247 GGGTTTGTCCTGTGCATTGTAGG + Intronic
1196494038 X:116302791-116302813 TTTTATATCCAGTGTATTGAGGG + Intergenic
1197330769 X:125151812-125151834 GGGTCTGTCCTGTGCATTGTAGG - Intergenic
1197453310 X:126644886-126644908 TTCTTTATCCAGTTCATTGTTGG - Intergenic
1198267684 X:135024557-135024579 TGATATATCCAGTGCATTGTTGG + Intergenic
1198318335 X:135492801-135492823 TTGAATGTCCAGTACATTGTTGG - Intergenic
1199602801 X:149552647-149552669 CGGTATATCCAGTGCGTTGTTGG - Intergenic
1199647588 X:149926828-149926850 CGGTATATCCAGTGCGTTGTTGG + Intergenic
1200539135 Y:4437638-4437660 TGGTATATCCAGTGCATTGTTGG + Intergenic
1201622295 Y:15973488-15973510 TGGTATATCCAGTGCATTGTTGG - Intergenic
1201623130 Y:15981936-15981958 TGGTATATCCAGTGCATTGTTGG - Intergenic
1201902683 Y:19059478-19059500 TGGTATATCCAGTGCATTGTTGG + Intergenic
1202177414 Y:22110482-22110504 TGGTATATCCAGTGCATTGTTGG - Intergenic
1202213947 Y:22475902-22475924 TGGTATATCCAGTGCATTGTTGG + Intergenic