ID: 1038666562

View in Genome Browser
Species Human (GRCh38)
Location 8:29542730-29542752
Sequence CAGTGCATTGTTGGCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 16, 1: 44, 2: 38, 3: 40, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038666554_1038666562 15 Left 1038666554 8:29542692-29542714 CCCCTGCCCTCACTAAATTTAAT No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666555_1038666562 14 Left 1038666555 8:29542693-29542715 CCCTGCCCTCACTAAATTTAATA No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666552_1038666562 29 Left 1038666552 8:29542678-29542700 CCATCACTAACCTACCCCTGCCC 0: 36
1: 72
2: 54
3: 72
4: 352
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666557_1038666562 9 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666553_1038666562 19 Left 1038666553 8:29542688-29542710 CCTACCCCTGCCCTCACTAAATT No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666556_1038666562 13 Left 1038666556 8:29542694-29542716 CCTGCCCTCACTAAATTTAATAA No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139
1038666558_1038666562 8 Left 1038666558 8:29542699-29542721 CCTCACTAAATTTAATAAGTGCT No data
Right 1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG 0: 16
1: 44
2: 38
3: 40
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038666562 Original CRISPR CAGTGCATTGTTGGCACCAC AGG Intergenic
901417115 1:9124983-9125005 CAGTGCATTGTTGGCACCGCGGG + Intronic
901946178 1:12705949-12705971 CAGTGCATTGTTGGCACCGCAGG + Intergenic
904349645 1:29896624-29896646 CAGTGCACAGATGGAACCACGGG + Intergenic
905437606 1:37968323-37968345 CACTGCATTGTTTGCCTCACTGG + Intronic
906561050 1:46757228-46757250 CAGTGCATTGGTGGCACCAAGGG + Intergenic
906898198 1:49802699-49802721 CAGTGCATTGTTGGCACCACGGG + Intronic
909049567 1:70752316-70752338 CAGTGCATTGGCGGCATCACGGG + Intergenic
910599784 1:89018801-89018823 CAGTGCATTGGCAGCACCACGGG + Intronic
910831610 1:91467125-91467147 CAGTGCATTGTTGGCACCATGGG + Intergenic
911755869 1:101556191-101556213 CAGTGCTTTGGTGGCATCACAGG + Intergenic
911848941 1:102789978-102790000 TAGTGCATTGGCGGCACCACAGG - Intergenic
912635193 1:111285343-111285365 CAGTGCTCTGTAGGTACCACAGG + Intergenic
913100620 1:115560720-115560742 CTGTCCATTGCTGCCACCACTGG + Intergenic
913537424 1:119786356-119786378 CAGTGTATTGTTGGCACCACAGG - Intergenic
913992613 1:143628549-143628571 CAGTGAATTGTGGGCACAGCAGG + Intergenic
915701589 1:157801955-157801977 CAGGCCATTGTTGGCCTCACAGG + Exonic
918018955 1:180665619-180665641 CAGCCCAGTGTTGGCAGCACTGG + Intronic
918270060 1:182889718-182889740 CAGTGGATAGCTGGGACCACAGG + Intergenic
919205429 1:194416590-194416612 CAGTGCATTGTTAGCACCGCAGG + Intergenic
919318320 1:196002163-196002185 CAGTGCATCGTTGGCACTATGGG - Intergenic
919707581 1:200692949-200692971 CAGTGGATTCCTGGAACCACAGG - Intergenic
919943415 1:202303861-202303883 AAGTTCATTCATGGCACCACTGG + Intronic
921975347 1:221196701-221196723 CAGTGCATTGTTGGCACCATGGG - Intergenic
924283325 1:242460286-242460308 CAGTGCATTGTTGGCACCACGGG + Intronic
1062802062 10:388189-388211 AAGTGGATTTTTGGCAACACAGG + Intronic
1065741563 10:28801713-28801735 CAGTGCATGATAGGAACCACAGG + Intergenic
1067095563 10:43297305-43297327 CAGTGCATAGGTGGCAGAACAGG + Intergenic
1067316827 10:45175528-45175550 CAGTGCATTGGCGGCATCACAGG - Intergenic
1068180971 10:53518298-53518320 CAGTGCATTGTTGGCACCGTGGG + Intergenic
1072175068 10:92912419-92912441 CAGTGCATTGGAGGCACCGTGGG - Intronic
1072386830 10:94939297-94939319 CAGTGCATTCTTGGCACCATGGG - Intronic
1072565868 10:96616122-96616144 CAGTCCATAGTGTGCACCACTGG + Intronic
1078096098 11:8298204-8298226 CAGTGAATTGGCGGCACCTCTGG + Intergenic
1079854670 11:25587086-25587108 CAGTGCACTGTTGGCTCAAGAGG - Intergenic
1079911512 11:26316254-26316276 CAGTGCATTGGTGGCATCGCAGG - Intronic
1080172274 11:29319270-29319292 CAGTGCATTGTTAGCACATGGGG + Intergenic
1080959032 11:37136160-37136182 TAGTGCATTGTTGGCACCATGGG + Intergenic
1081084724 11:38785694-38785716 CAGTGCATTGTTGGCACCGTGGG + Intergenic
1081244478 11:40747117-40747139 CAGCCCATTGTTGCCACCACTGG + Intronic
1081244494 11:40747172-40747194 CGGCCCATTGTTGCCACCACTGG + Intronic
1081450029 11:43161874-43161896 CAGTGCATTGGCAGCACCATGGG - Intergenic
1081450625 11:43167889-43167911 CAGTGCATTGGCAGCACCATGGG - Intergenic
1084221352 11:67681922-67681944 CAGTGCATTGTTGGCACTGCAGG - Intergenic
1085868767 11:80325876-80325898 CAGTGCCTTGTAGGGACCAAGGG - Intergenic
1086526638 11:87735298-87735320 CAGATCCTTGTTGGCACCATTGG - Intergenic
1086957021 11:92943705-92943727 CAGTGCATCGTTGGCACCGTGGG - Intergenic
1086957574 11:92949369-92949391 CAGTGCATTGTTGGCACTGCGGG - Intergenic
1087579350 11:100031906-100031928 CAGTGCATTGGTGGCACCACGGG + Intronic
1094110036 12:26852859-26852881 GAGTGCATTAATGGCACCAAAGG - Intergenic
1095092905 12:38123555-38123577 CAGTTCATTGGTGGCATCGCAGG + Intergenic
1095093510 12:38129968-38129990 CAGTGCATTGACAGCACCACTGG + Intergenic
1096892385 12:54785468-54785490 CAGCCCATTGTTGCCACCAATGG - Intergenic
1096915518 12:55027700-55027722 CAATGAGTTTTTGGCACCACTGG - Exonic
1096934526 12:55256702-55256724 CAGTGCATTAGTGGCATCGCGGG + Intergenic
1098747674 12:74260714-74260736 CAGTGCATTGTTGGCACTGCGGG + Intergenic
1099810704 12:87578938-87578960 CAGTGCATTGGTGGCACCATGGG - Intergenic
1101285324 12:103306094-103306116 CAGTTCATTTTTGGAACAACTGG - Exonic
1101329385 12:103745196-103745218 CAGTGCGATGATGGCATCACGGG + Exonic
1102326991 12:111994460-111994482 CAGTGCATTGGCGGCATCACAGG - Intronic
1104089119 12:125500038-125500060 CAGTGCATTGTTGGCACCATGGG + Intronic
1104139624 12:125974872-125974894 CAGTGCATTGTTGGCACCGCGGG + Intergenic
1107629532 13:42328981-42329003 CAGAATATTGTTGGCACCATGGG - Intergenic
1112028044 13:95430433-95430455 CAGTGCATTGTTGGCATCATGGG - Intergenic
1112456583 13:99568652-99568674 CAGTGCATTGGCGGCATCGCAGG - Intergenic
1114599671 14:23944207-23944229 CAGTGCGTTGTTGGCACCACGGG - Intergenic
1118449585 14:65888000-65888022 CCGCTCATTGTTGCCACCACTGG + Intergenic
1118826240 14:69385040-69385062 CAGTTCATTGTAGGTCCCACTGG - Intronic
1118961776 14:70539877-70539899 CAGTGCATTGGCAGCACCATGGG + Intergenic
1119101683 14:71885698-71885720 CAGTGCATTCTTTGGAACACAGG + Intergenic
1121758361 14:96422054-96422076 CAGTGCATTGTTGGCACCACGGG - Intronic
1123208140 14:106733565-106733587 CAGTGCATTGTTGGCACCATGGG + Intergenic
1123800899 15:23819410-23819432 CAGTGCATTGGCAGCATCACAGG - Intergenic
1129567732 15:76641433-76641455 CAGTGCATTGTTGGCACCACGGG + Intronic
1131809652 15:96159458-96159480 CAGTTCATGGTTGGCAAAACAGG - Intergenic
1136871839 16:33814417-33814439 CAGTGCATTGTTGGCACTGTGGG + Intergenic
1139285909 16:65813895-65813917 CAGTGCATTGTTGGCACCGCGGG + Intergenic
1141505627 16:84476154-84476176 CAGTGCATTGTTGCCGACTCTGG - Intergenic
1203100333 16_KI270728v1_random:1301651-1301673 CAGTGCATTGTTGGCACTGTGGG - Intergenic
1142831995 17:2556039-2556061 CAGTGCAGCCTTGGCACCTCAGG - Intergenic
1143470262 17:7169596-7169618 CAGTGCATTGGCGGCATCACAGG + Intergenic
1145730608 17:27181359-27181381 CAGTGCATTGTTGGCATCATGGG - Intergenic
1147539099 17:41341961-41341983 CAGTGCATTGGTGGCATCGCAGG - Intergenic
1149165622 17:53748780-53748802 CAGTGCATTGGCGGCATCACAGG + Intergenic
1152056132 17:78028322-78028344 AAATGAATTGTTGACACCACTGG + Intronic
1152061850 17:78082209-78082231 CAGTGCATTGGTGGCATCACAGG - Intronic
1153615107 18:6926865-6926887 GAGTGCAGTGTTGTTACCACAGG - Intergenic
1154087781 18:11323685-11323707 CAGGGCTTTCTTGGCACCCCAGG + Intergenic
1154478846 18:14796758-14796780 CAGTGAATTGTTGGCACTACGGG - Intronic
1154478996 18:14798194-14798216 CAGTGAATTGTTGGCACCACGGG - Intronic
1154479797 18:14809085-14809107 TAGTGAATTGTTGGCACCACGGG - Intronic
1155807586 18:30191967-30191989 CAGTCTATTTTTGCCACCACTGG - Intergenic
1157974147 18:52306961-52306983 CTGTGCATTCTTGGCACCCTTGG - Intergenic
1159118773 18:64145411-64145433 CAGTGCATTGTTGGCACCATGGG + Intergenic
1160167165 18:76523953-76523975 TAGTGCAAAGTTGGCACCCCTGG - Intergenic
1162289001 19:9764595-9764617 CAGTGCATTGTTGGCACTGTGGG + Intronic
1164512924 19:28912029-28912051 AAGTGCAGAGTTGGGACCACAGG - Intergenic
1165566817 19:36736738-36736760 CAGTGCATTGTTGGCACCGCGGG + Intronic
1166469021 19:43061365-43061387 CAGTGCATTGGTAGCATCGCAGG - Intronic
924983073 2:240660-240682 CAGGGCATTGTTGGAAACAATGG + Intronic
926969703 2:18454179-18454201 CAGTGCACTGTTGCCACCCTGGG - Intergenic
930130905 2:47849408-47849430 CACTGAATTTTTGCCACCACAGG + Intronic
931461384 2:62453229-62453251 CAGCCCATTGTTGGGACTACAGG - Intergenic
932934211 2:76082795-76082817 CACTGAATTGGTGGCACCATCGG - Intergenic
935248972 2:101244942-101244964 CAGTGCATTGACGGCATCGCGGG + Intronic
936231214 2:110700831-110700853 ACGTGCAGTGTTGGCACCAGGGG - Intergenic
936802966 2:116288913-116288935 CAGTGCATTGTTGGCACCATGGG + Intergenic
939268926 2:139912778-139912800 CAGTGCATTGTTGGCACCACAGG - Intergenic
939482137 2:142762219-142762241 CAGCCCACTGTTGCCACCACTGG + Intergenic
939507919 2:143072111-143072133 CATAGCATTGTTTGCACCAGGGG - Intergenic
941297979 2:163764234-163764256 CAGTACATTTGTGGCACAACAGG + Intergenic
941894535 2:170615795-170615817 CAGTGCATTGTTGGCACCATGGG - Intronic
941894819 2:170618666-170618688 CAGAGCATTGTTGGCACCATGGG - Intronic
943314978 2:186375875-186375897 CAGTGCATTGTTGGCACTGCGGG + Intergenic
945272075 2:207950853-207950875 CAGAGCATTCTTGTCTCCACTGG + Intronic
945325931 2:208482353-208482375 CAGTGCATTGTTGGCACTGTGGG - Intronic
946706647 2:222464853-222464875 AAGAGCATTGTTGCCACCATGGG + Intronic
947303309 2:228714724-228714746 CAGTGCATTGGCGGCACCATAGG - Intergenic
947355390 2:229289444-229289466 CAGTGCATTGGCAGCACCGCGGG + Intergenic
948990035 2:241549084-241549106 AAGTGCATTGGTGCCATCACAGG - Intergenic
1171064162 20:21996321-21996343 CAGTTCATTGATGACACCATTGG + Intergenic
1171072483 20:22087548-22087570 AAATGAATGGTTGGCACCACTGG + Intergenic
1172993340 20:39051970-39051992 CAGTGTATTATGGGCACCTCTGG - Intergenic
1176512146 21:7756787-7756809 CAGGTCATTGTAGGAACCACTGG + Intronic
1176726829 21:10443047-10443069 CTGTACATTGTTGCCAGCACTGG + Intergenic
1176800743 21:13427217-13427239 CAGTGAATTGTTGGCACCACGGG + Intergenic
1177445520 21:21190539-21190561 AAGTGTATTGTTAGCACCAGCGG - Intronic
1178646258 21:34387312-34387334 CAGGTCATTGTAGGAACCACTGG + Intronic
1178679511 21:34660536-34660558 CAGTGCATTGATGACAGCAGTGG - Intergenic
1179821961 21:43942297-43942319 TTCTGCATTGATGGCACCACGGG + Intronic
1181181585 22:21072432-21072454 CAGTGCATTGTTGGCACCATGGG + Intergenic
1182242953 22:28931746-28931768 TAGTACAATGTTGGCTCCACAGG - Intronic
1182910333 22:33978918-33978940 CAGTGCATCGGCGGCACCACAGG + Intergenic
1184127490 22:42498419-42498441 CCGTGCATTGTTGGCACTGAGGG - Intergenic
1185319803 22:50195328-50195350 CAGTGCAAGGTTGGCCCCCCCGG + Intronic
949663302 3:6307071-6307093 CTGTGCATTGGCGGCATCACAGG - Intergenic
951294877 3:20921564-20921586 CAGTGCATTGTTGGCACCGCGGG - Intergenic
952243640 3:31562015-31562037 CAGTTCACTGCTGCCACCACTGG - Intronic
952549192 3:34456930-34456952 CAGTCCATTGTTGCCACTTCTGG - Intergenic
952608094 3:35173795-35173817 CAGTGCATTGATGGCATTGCAGG + Intergenic
954872414 3:53777665-53777687 CAGAGCTTTGTGGCCACCACAGG + Intronic
954947358 3:54437826-54437848 GACTGCAGTGTTGGCACCTCTGG - Intronic
955034034 3:55248936-55248958 CAGTGCGTTAGTGGCACCATGGG - Intergenic
956816636 3:72914052-72914074 CAGGGCATTGTGGGCAACCCAGG + Intronic
957787029 3:84896537-84896559 CAGTGCATTGGCAGCATCACGGG - Intergenic
958481195 3:94647901-94647923 CAGTGCATTGTTGACACTGCAGG + Intergenic
959261764 3:104090925-104090947 CAGTGCATTATTGGCACCATGGG + Intergenic
959439753 3:106360775-106360797 CAGTGCATTGGCGGCATCGCGGG - Intergenic
962273548 3:133995681-133995703 CTCTGCCTTGCTGGCACCACAGG - Intronic
963166313 3:142207686-142207708 CAGTGCATTGTTGGCACCGCAGG + Intronic
963901745 3:150739793-150739815 CAGTGCATTACTGGCAGCACTGG - Intergenic
964004037 3:151808755-151808777 CAGTGCATTGTTGGCACTGCAGG - Intergenic
965192417 3:165548738-165548760 CAGTGCATTGGTGGCATCGCAGG + Intergenic
965795841 3:172437843-172437865 CAGTGCCTTGTCAGCACTACAGG + Intergenic
967590448 3:191267597-191267619 CAGTGCATTGTTGGCACCATGGG - Exonic
973794378 4:54409126-54409148 CAGTGTATTGCTGGCACTGCAGG - Intergenic
973803165 4:54498340-54498362 CAGTGAAGTGCTGGCACCATAGG + Intergenic
975619511 4:76281898-76281920 CAGTGCATTGTTGGCACCGTGGG - Intronic
975936870 4:79592054-79592076 CAGTGCATTGTTGGCACCGCAGG - Intergenic
976636447 4:87291145-87291167 CAGTGCATTGTTGGCACCGCGGG - Intergenic
977058079 4:92218468-92218490 CAGTGCATTGGTGGCACCACGGG + Intergenic
977511614 4:97969457-97969479 CAGTGCATTGGCAGCATCACAGG + Intronic
977630036 4:99232326-99232348 CAGTGCATTGTTGGCACCACGGG + Intergenic
977878561 4:102177969-102177991 AAATGCAGTGTGGGCACCACTGG - Intergenic
978544779 4:109859205-109859227 TAGTGCATTGGTGGCACCGTGGG - Intronic
978613740 4:110572265-110572287 CAGCCCATTGCTGCCACCACTGG + Intergenic
980661437 4:135864090-135864112 CAGTGCATTGTTGGCACCATGGG - Intergenic
981420405 4:144543271-144543293 CAGTGCATTGTTGACATCACGGG + Intergenic
984109532 4:175595423-175595445 CAGTGCATTGTTAGCACCACAGG + Intergenic
985866048 5:2515445-2515467 CAGCGCATTGGCTGCACCACAGG + Intergenic
986890205 5:12294689-12294711 CAGTGCATCGTTGGCACTGTGGG + Intergenic
987609247 5:20180701-20180723 CAGTGCATTGTTGGCACCATGGG + Intronic
988769852 5:34421499-34421521 CAGTGCATTGTTGGCACCGTGGG - Intergenic
989482308 5:41946117-41946139 CAGTGCATTGTTGGCACCATGGG + Intergenic
989559436 5:42834406-42834428 CAGTGCATTGGCGGCATCACAGG - Intronic
989570101 5:42938113-42938135 CAGTGCATTGGTGGCATCGCAGG + Intergenic
990017347 5:51080441-51080463 CAGAGCATTCTTGACAACACTGG + Intergenic
992818690 5:80471566-80471588 CAGTGCATCGTTGGCACCACGGG + Intronic
995382235 5:111548136-111548158 CAGTGCAGTGCTGGCTCCAGAGG + Intergenic
995632528 5:114149489-114149511 CAGTGCATTGGCGGCATCACGGG - Intergenic
995794296 5:115925412-115925434 CACTGCAGTGTTGGCACAATAGG + Intergenic
996467782 5:123823558-123823580 CAGTCCACTGCTGGCACTACTGG + Intergenic
997588012 5:135055594-135055616 CAGGGCAGTGTTGGCAGCATCGG + Intronic
999521836 5:152358896-152358918 CAGTGCATTGTTGGCACCGCAGG + Intergenic
999682500 5:154073128-154073150 CAGTGCATTGGTGGCACCGCGGG - Intronic
999722267 5:154407351-154407373 CAGTTCACTGTTTGCACCAAAGG - Intronic
1000708756 5:164544776-164544798 CAGTGCATTGGTGGCACCGCGGG + Intergenic
1001951983 5:175822745-175822767 CAGAGCTTTGCTGACACCACTGG - Intronic
1002114254 5:176946119-176946141 CAGTGCATTGTTGGCACCCCAGG + Intronic
1003041820 6:2694963-2694985 TACTACATAGTTGGCACCACAGG + Intronic
1006080485 6:31562739-31562761 CAGTGAATAGCTGGGACCACAGG - Intergenic
1008272021 6:49501388-49501410 CAGTGCATTGGCGGCACCGCGGG - Intronic
1008272649 6:49507819-49507841 CAGTGCATTGGTGGCACTGCAGG - Intronic
1009592444 6:65689944-65689966 CAGTGCATTGTTGGTACTGCGGG - Intronic
1009616085 6:66009437-66009459 AAGTCCATTGGTGCCACCACTGG - Intergenic
1009651543 6:66482495-66482517 CAGTGCATTGTTGGCACCACGGG - Intergenic
1010902171 6:81441458-81441480 CAGTGCATGGTTGGCACCATGGG + Intergenic
1011262778 6:85486020-85486042 CAGTGCATTGTTGGCACCGCAGG - Intronic
1013522366 6:110945045-110945067 CACTGCATCCTTGGCACCCCAGG + Intergenic
1014405197 6:121042792-121042814 CAGTGCATTGGCGGCATCATGGG + Intergenic
1014405835 6:121049190-121049212 CAGTGCATTGGCGGCATCACGGG + Intergenic
1015078647 6:129195586-129195608 CAGTGAATATTTGGCACAACTGG + Intronic
1017682242 6:156876121-156876143 CAGTGCCTGGTAGGTACCACGGG - Intronic
1017801540 6:157900542-157900564 CAGTGCATTGTTGGCACTGCAGG - Intronic
1018695231 6:166385714-166385736 TAATGCACTGTTGCCACCACTGG + Intergenic
1018763970 6:166915265-166915287 CAGTGCATTGTTGGCACTGCAGG - Intronic
1019048170 6:169163604-169163626 CAGTGCATAGTTCCCACCCCCGG - Intergenic
1019356522 7:582760-582782 CAGTGCCTGGTGGGCACCAGGGG + Intronic
1019693135 7:2428523-2428545 CAGTGCATTGGCGGCATCGCAGG - Intronic
1022450472 7:30509170-30509192 CAGTGCATTGGCGGCACCACGGG - Intronic
1022621407 7:31988180-31988202 CAGGGGGTTGTTGCCACCACTGG - Intronic
1025735610 7:64144080-64144102 CAGTGCATTGTTGGCACTGCAGG - Intronic
1027491525 7:78833381-78833403 CAGTGCATTGGAGGCATCAAGGG + Intronic
1028180354 7:87714293-87714315 CAGTGCATTGTTGGCACCGTGGG - Intronic
1028181748 7:87732662-87732684 TAGTGCATTGTTGGCACCACGGG - Intronic
1028400117 7:90416449-90416471 CAGTGAACTGTTAGGACCACAGG - Intronic
1028707738 7:93869999-93870021 CAGTGCATTGTTGGCACCGTGGG - Intronic
1029043130 7:97598461-97598483 CAGTGCATTGTTGGCACCACAGG + Intergenic
1029237869 7:99137435-99137457 CAGTCCAGTGTTGGAACCACAGG + Intronic
1029464821 7:100718888-100718910 TGGTGCATTGTTGACACCACGGG + Intergenic
1029946442 7:104538297-104538319 CAGTGTATTTTTAGCACCTCGGG - Intronic
1032974450 7:137206302-137206324 CAGTGCATTGTTGGCACCATGGG + Intergenic
1033502191 7:141963095-141963117 CAGTGCATTGCTGGCACCGCGGG + Intronic
1034603283 7:152284912-152284934 CTGTACATTGTTGCCAGCACTGG - Intronic
1034716207 7:153244813-153244835 CAGTACATTGTTGGCACCGTGGG - Intergenic
1034777507 7:153843531-153843553 CAGTGCATTGGTGGCATCTCAGG - Intergenic
1036083944 8:5592141-5592163 CAGTGCATTGGTGGCACCATAGG + Intergenic
1036613684 8:10372097-10372119 TAGAGCAGTGTTGGCAGCACTGG + Intronic
1036737478 8:11331204-11331226 CAGGCCATTGGTGGCACCAGAGG - Exonic
1037005002 8:13767450-13767472 CAGTACATTGGTGGCATCGCAGG - Intergenic
1038006544 8:23435327-23435349 TAATGCAGTGTTGGCCCCACTGG - Intronic
1038666562 8:29542730-29542752 CAGTGCATTGTTGGCACCACAGG + Intergenic
1040277245 8:46020315-46020337 CAGTGCTTTGGTGGCATCACGGG + Intergenic
1041066818 8:54090617-54090639 CAGTGCATTGTTGGCACCGCGGG + Intronic
1041296356 8:56361283-56361305 CAGTGCATTGTTGGCACCTTGGG + Intergenic
1041313409 8:56538666-56538688 CTGTGCACTGTTGGCCCCAGGGG - Intergenic
1044091149 8:88003301-88003323 CAGTGCATTGTTGGCAGCAGGGG - Intergenic
1046498375 8:115043308-115043330 CAGGCCATTCCTGGCACCACAGG + Intergenic
1047451172 8:124966307-124966329 CAGTGCATTGTTGGCATAGCGGG + Intergenic
1048422265 8:134288853-134288875 CAGTGCATTGTTGGCACCGCGGG + Intergenic
1048431941 8:134378639-134378661 CAGTGCATTGTTGGCACCATGGG - Intergenic
1049642368 8:143721464-143721486 CTGCGCATAGTTGGCAGCACAGG - Intronic
1050457769 9:5849990-5850012 CCTTGCAGTGTAGGCACCACAGG + Intergenic
1055694775 9:78872028-78872050 GTGAGCATTGTGGGCACCACTGG + Intergenic
1058382624 9:104394656-104394678 CAGTGCATTGTTGGCACCATGGG - Intergenic
1060209767 9:121702372-121702394 CAGTGCTTGGTTGGCACAGCTGG + Intronic
1060345193 9:122809787-122809809 CAGTGCATTGTTGGCACCACGGG + Intronic
1060435236 9:123587085-123587107 CAGTGCATTGTTGGCACCGCAGG - Intronic
1186120434 X:6355354-6355376 CAGTGCATTGTTGGCACCGTGGG - Intergenic
1186296482 X:8154526-8154548 CAGTGCATTGTTGGCACCGCGGG + Intergenic
1186971411 X:14848872-14848894 CAGTGCATTGTTGGCAGTGTGGG + Intronic
1187526095 X:20056601-20056623 CAGGGGATTATGGGCACCACTGG - Intronic
1187613654 X:20970064-20970086 CAGTGCTTCGTTGGTATCACTGG + Intergenic
1188022724 X:25176224-25176246 GAGTCCATTGCTGGTACCACTGG + Intergenic
1188285045 X:28316271-28316293 CAGTCCAATGCTGCCACCACTGG + Intergenic
1188639234 X:32478246-32478268 CAGTGCATTTTTTTCCCCACAGG - Intronic
1189017284 X:37297332-37297354 CAGTGCATTGTTGGCACCGCAGG - Intergenic
1191238060 X:58152285-58152307 CTGTGCATTGTTGACACCACGGG - Intergenic
1191269481 X:58445004-58445026 CAGTGCATTGTTGGCACTGTGGG - Intergenic
1193023836 X:76822290-76822312 CAGTGCATTGTTGGCACCGTGGG - Intergenic
1193442592 X:81561396-81561418 CAATGCATTGGTGGCATCATAGG + Intergenic
1193565495 X:83071143-83071165 CAGTGCATTGTTGGCACCACGGG + Intergenic
1194192506 X:90855203-90855225 CAGTGCATTGTTGGCACCACGGG + Intergenic
1195506701 X:105666324-105666346 CAGTGCATTGTTGGCACCACGGG - Intronic
1197638119 X:128939408-128939430 GAGTGGATCGTTGGCAACACAGG + Intergenic
1197792041 X:130265593-130265615 AAGTGCATTGATGGGAACACTGG + Intronic
1198267687 X:135024566-135024588 CAGTGCATTGTTGGCACCGCGGG + Intergenic
1199602798 X:149552638-149552660 CAGTGCGTTGTTGGCACCGTGGG - Intergenic
1199647591 X:149926837-149926859 CAGTGCGTTGTTGGCACCGTGGG + Intergenic
1200539138 Y:4437647-4437669 CAGTGCATTGTTGGCACCACGGG + Intergenic
1200858148 Y:7961131-7961153 CAGTGCATTGGCAGCATCACAGG - Intergenic
1200905229 Y:8474975-8474997 CAGTGCATTGTTTACACCGTGGG - Intergenic
1201510512 Y:14755786-14755808 CAGTGCAGTGGTGTCATCACAGG - Intronic
1201622292 Y:15973479-15973501 CAGTGCATTGTTGGCACCATGGG - Intergenic
1201623127 Y:15981927-15981949 CAGTGCATTGTTGGCACTGTGGG - Intergenic
1201902686 Y:19059487-19059509 CAGTGCATTGTTGGCACCATGGG + Intergenic
1202177412 Y:22110473-22110495 CAGTGCATTGTTGGCACCACAGG - Intergenic
1202213949 Y:22475911-22475933 CAGTGCATTGTTGGCACCACAGG + Intergenic