ID: 1038666563

View in Genome Browser
Species Human (GRCh38)
Location 8:29542739-29542761
Sequence GTTGGCACCACAGGACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038666556_1038666563 22 Left 1038666556 8:29542694-29542716 CCTGCCCTCACTAAATTTAATAA No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666553_1038666563 28 Left 1038666553 8:29542688-29542710 CCTACCCCTGCCCTCACTAAATT No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666557_1038666563 18 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666558_1038666563 17 Left 1038666558 8:29542699-29542721 CCTCACTAAATTTAATAAGTGCT No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666554_1038666563 24 Left 1038666554 8:29542692-29542714 CCCCTGCCCTCACTAAATTTAAT No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data
1038666555_1038666563 23 Left 1038666555 8:29542693-29542715 CCCTGCCCTCACTAAATTTAATA No data
Right 1038666563 8:29542739-29542761 GTTGGCACCACAGGACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038666563 Original CRISPR GTTGGCACCACAGGACCAGA AGG Intergenic
No off target data available for this crispr