ID: 1038666564

View in Genome Browser
Species Human (GRCh38)
Location 8:29542742-29542764
Sequence GGCACCACAGGACCAGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 4, 1: 20, 2: 51, 3: 52, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038666555_1038666564 26 Left 1038666555 8:29542693-29542715 CCCTGCCCTCACTAAATTTAATA No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666557_1038666564 21 Left 1038666557 8:29542698-29542720 CCCTCACTAAATTTAATAAGTGC No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666558_1038666564 20 Left 1038666558 8:29542699-29542721 CCTCACTAAATTTAATAAGTGCT No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666554_1038666564 27 Left 1038666554 8:29542692-29542714 CCCCTGCCCTCACTAAATTTAAT No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666561_1038666564 -10 Left 1038666561 8:29542729-29542751 CCAGTGCATTGTTGGCACCACAG No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254
1038666556_1038666564 25 Left 1038666556 8:29542694-29542716 CCTGCCCTCACTAAATTTAATAA No data
Right 1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG 0: 4
1: 20
2: 51
3: 52
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038666564 Original CRISPR GGCACCACAGGACCAGAAGG CGG Intergenic
900348631 1:2224360-2224382 GGCGCCCCAGGACCAGAAAGAGG - Intergenic
901195086 1:7435933-7435955 GGCACCTCAGGAGCAGAGGAGGG + Intronic
901519051 1:9768867-9768889 GGCACCAAAGCAACAGAAGAGGG + Intronic
901946180 1:12705961-12705983 GGCACCGCAGGACCAGAAGGTGG + Intergenic
903004877 1:20291939-20291961 GGCACCACAGCAGCAGAAGGAGG + Intronic
903190743 1:21654166-21654188 GTCACCAAAGGACCAGGAGCTGG - Intronic
903929311 1:26853275-26853297 GGCACCAGAGTTCCAGAACGGGG + Intronic
904370570 1:30045243-30045265 GGGCACACAGGACCAGAACGGGG + Intergenic
904419533 1:30382720-30382742 AGCACCTCAGGAGGAGAAGGAGG + Intergenic
905270627 1:36785305-36785327 AGCCCCACAGGAGCAGAAAGTGG - Intergenic
905388581 1:37621588-37621610 GGGACCACAGGAGGAGGAGGGGG + Intronic
905559663 1:38916444-38916466 GGTACCAGAGGAACAGAAAGAGG + Intronic
905839570 1:41163106-41163128 GGAACCACAGGGCCGGAAAGAGG - Intronic
906082313 1:43101439-43101461 GGCACCACAGGACCACAAAGAGG + Intergenic
906087537 1:43148640-43148662 GGCACCTCAGACCCAGCAGGAGG + Intronic
906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG + Intergenic
906845463 1:49186645-49186667 GGTATCACAGATCCAGAAGGAGG + Intronic
906898200 1:49802711-49802733 GGCACCACGGGACCAGAAGGCGG + Intronic
907269969 1:53285284-53285306 GGCACCACTGGCCCAGAGAGAGG + Intronic
907802990 1:57790014-57790036 GGCACCAACGGACCATAAGAGGG + Intronic
908107638 1:60861502-60861524 CACAGCACAGGAGCAGAAGGGGG + Intergenic
909049569 1:70752328-70752350 GGCATCACGGGACTAGAAGGCGG + Intergenic
910361746 1:86419452-86419474 TGCACCCCAAGAACAGAAGGGGG + Intergenic
910831612 1:91467137-91467159 GGCACCATGGGACCAGAAGGCGG + Intergenic
910909545 1:92218690-92218712 GGGACCGGGGGACCAGAAGGTGG - Intronic
911755871 1:101556203-101556225 GGCATCACAGGACCAGAAGGTGG + Intergenic
913243343 1:116849967-116849989 GGCTCCAGAGAACCAGAAGATGG - Intergenic
913442106 1:118909109-118909131 GGCACCACAGGACTGAAATGTGG + Intronic
913509000 1:119545611-119545633 GGGACCACAAGACCAGAATGTGG - Intergenic
913537422 1:119786344-119786366 GGCACCACAGGACCAGAAGGCGG - Intergenic
914379516 1:147103963-147103985 AGCATCATGGGACCAGAAGGTGG + Intergenic
914681902 1:149944447-149944469 GGCAGAACAGAAGCAGAAGGAGG - Exonic
915598736 1:156909533-156909555 GGCACCCCAGACCCAGAATGGGG + Intronic
915881106 1:159672680-159672702 AGCATCACAGGTTCAGAAGGTGG - Intergenic
917394297 1:174575835-174575857 AGCATTGCAGGACCAGAAGGCGG - Intronic
918572680 1:186016731-186016753 GGCACCATAGTACTAGATGGAGG + Intronic
919205431 1:194416602-194416624 AGCACCGCAGGACCAGAAGGCGG + Intergenic
919318318 1:196002151-196002173 GGCACTATGGGACCAGAAGGTGG - Intergenic
919854167 1:201694384-201694406 GGCACCCTAGGCTCAGAAGGAGG - Intronic
921975345 1:221196689-221196711 GGCACCATGGGACCAGAAGGCGG - Intergenic
922190603 1:223315476-223315498 GGGGCCACAGGACCAGTTGGCGG - Intronic
922578609 1:226680395-226680417 GGCATCCCAGAACCAGCAGGAGG + Intronic
922774914 1:228210244-228210266 TGAATCACAGGACCAGGAGGAGG + Intronic
922774928 1:228210301-228210323 GGCAGCCCAGGCCCAGAAGCTGG + Intronic
923265231 1:232307415-232307437 GGAATCAGAGGAACAGAAGGAGG - Intergenic
923616723 1:235544503-235544525 GCCACCACAGGTCTAGCAGGAGG - Intergenic
923778235 1:236998773-236998795 GGGACTGCAGGACCAGGAGGTGG - Intergenic
924950868 1:248882174-248882196 GGCTCCGTGGGACCAGAAGGCGG - Intergenic
1063568428 10:7192832-7192854 GGCACCCCTGAACCAGAATGCGG - Intronic
1064573891 10:16724605-16724627 GGCAGAAGAGGAGCAGAAGGGGG + Intronic
1065133253 10:22643750-22643772 GGAACCACAGAACCAGAAGATGG + Intronic
1067316825 10:45175516-45175538 GGCATCACAGGACCAGAAGGTGG - Intergenic
1067783543 10:49226544-49226566 GGAAACACAGGAAAAGAAGGAGG + Intergenic
1068387142 10:56345417-56345439 GGCACAGCAGCACCAAAAGGTGG + Intergenic
1069771178 10:70901466-70901488 AGCACAACAGGACCTGATGGCGG - Intergenic
1069868460 10:71518756-71518778 GGCACCTAAGAACCAGAAAGAGG - Intronic
1071073883 10:81728664-81728686 GGAACCACAGGAACAGTAGGTGG + Intergenic
1072386828 10:94939285-94939307 GGCACCATGGGACCAGAAGGCGG - Intronic
1072577064 10:96709977-96709999 GGCACCCCTGGACAAGAATGAGG + Exonic
1073784822 10:106877774-106877796 TGCACCACAGAACCAGAATACGG - Intronic
1074693727 10:116029471-116029493 CTCACCACAGCCCCAGAAGGTGG + Intergenic
1075166337 10:120071290-120071312 GGGAACACAGCACCAGGAGGGGG + Intergenic
1075777272 10:124997015-124997037 GGCACCCCAGGTCCAGAGCGGGG + Intronic
1076342103 10:129756289-129756311 AGCACCACAGGACAGGCAGGAGG + Intronic
1077350609 11:2091492-2091514 GCCACCCCAGAACCAGCAGGTGG + Intergenic
1077776774 11:5280806-5280828 GGTTACACAGAACCAGAAGGCGG + Intronic
1078946187 11:16071048-16071070 GGGACCACTGGGCCAGAAGCTGG - Intronic
1079911510 11:26316242-26316264 GGCATCGCAGGACCAGAAGGCGG - Intronic
1080183261 11:29448687-29448709 TGCTCCAAAGGACCAGAAGACGG + Intergenic
1080647912 11:34200164-34200186 AGAACCACAGGACCACAAGGAGG + Intronic
1081450028 11:43161862-43161884 AGCACCATGGGACCAGAAAGTGG - Intergenic
1081450622 11:43167877-43167899 AGCACCATGGGACCAGGAGGTGG - Intergenic
1081757680 11:45556328-45556350 GGCACCACTAGACAAGAGGGTGG + Intergenic
1081759510 11:45567427-45567449 GGAACCACATGACTTGAAGGAGG + Intergenic
1083215944 11:61219943-61219965 GGCACCAGAGGACGTGAACGTGG + Intergenic
1083218828 11:61238769-61238791 GGCACCAGAGGACGTGAACGTGG + Intergenic
1084325036 11:68395353-68395375 GGCGTCACAGTAGCAGAAGGGGG + Intronic
1084576461 11:69991762-69991784 GTAGCCATAGGACCAGAAGGTGG + Intergenic
1084793802 11:71491130-71491152 GGCACCACAGGAAGAAAGGGAGG - Intronic
1085047889 11:73363889-73363911 GGGACCAGATGAACAGAAGGAGG - Intronic
1085265280 11:75234289-75234311 GGAACCCCAGGACCAGAAACTGG - Intergenic
1085388096 11:76168568-76168590 GGCTCTACAGGACGAGACGGTGG - Intergenic
1085739436 11:79066201-79066223 GGGAGCGCAGGAGCAGAAGGTGG + Intronic
1086084214 11:82938342-82938364 GGCACAAAAGGACAATAAGGAGG - Intronic
1086957572 11:92949357-92949379 GGCACTGCGGGACCAGAAGGCGG - Intergenic
1087266864 11:96070449-96070471 GGCACCGCAGGACCCCAAAGAGG - Intronic
1087579352 11:100031918-100031940 GGCACCACGGGACCAGAAGGTGG + Intronic
1088564174 11:111150162-111150184 GGCTCTACAGGAACAGCAGGTGG + Intergenic
1089295481 11:117464821-117464843 TGGACCACAGGACCAAAATGGGG + Intronic
1090514533 11:127411564-127411586 GGAACCACAGGGCCCCAAGGAGG + Intergenic
1090592468 11:128287139-128287161 GCCACCTCAGGACCAGAAGTGGG - Intergenic
1094465026 12:30744028-30744050 GGGACCACTGGGGCAGAAGGAGG - Intronic
1094808254 12:34110973-34110995 AGCACCGCGGAACCAGAAGGCGG + Intergenic
1095092907 12:38123567-38123589 GGCATCGCAGGACCAGAAGGCGG + Intergenic
1095093512 12:38129980-38130002 AGCACCACTGGACAAGAAGGCGG + Intergenic
1096934528 12:55256714-55256736 GGCATCGCGGGACTAGAAGGCGG + Intergenic
1097179877 12:57165777-57165799 GGCACCACAGGATCGTGAGGGGG - Intronic
1098180490 12:67841101-67841123 GACAGCACAGGTCCAGAAAGGGG - Intergenic
1098747676 12:74260726-74260748 GGCACTGCGGGACCAGAAGGTGG + Intergenic
1099304507 12:80937392-80937414 GGGACCCCAGAGCCAGAAGGAGG + Intronic
1099810702 12:87578926-87578948 GGCACCATGGGACCAGAAGGTGG - Intergenic
1101517551 12:105450927-105450949 GCCACAACAGTACCAAAAGGAGG - Intergenic
1102326989 12:111994448-111994470 GGCATCACAGGACCAGAAGGCGG - Intronic
1102469536 12:113152002-113152024 GGCCCTGCAGGCCCAGAAGGAGG + Exonic
1102632789 12:114296447-114296469 CAGACCACAGGCCCAGAAGGAGG - Intergenic
1104089121 12:125500050-125500072 GGCACCATGGGACCAGAAGGCGG + Intronic
1104139626 12:125974884-125974906 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1105015528 12:132784355-132784377 GGCACCACAGGAAGTGAGGGGGG - Intronic
1105886480 13:24647000-24647022 GGCATTGCAGGACCAGAAGGCGG + Intergenic
1106956499 13:34943306-34943328 GGCAGGAGAGGACCAGAAAGAGG - Intronic
1109105249 13:58241828-58241850 GGCACTGCAGGACCAGAAGGTGG + Intergenic
1110864009 13:80374727-80374749 GGGGCCAAAGGACCAGAAAGAGG + Intergenic
1112115470 13:96347363-96347385 GGCAGCAAAAGACCAGAATGAGG - Intronic
1113572982 13:111371896-111371918 AGCAGCGCAGGATCAGAAGGTGG - Intergenic
1113626318 13:111850616-111850638 GGCACCACAGGGCAGGAGGGTGG - Intergenic
1113900459 13:113793935-113793957 GGCCCCACAGCAGCAGAAGGCGG - Intronic
1114599669 14:23944195-23944217 GGCACCACGGGACCAAAAGGCGG - Intergenic
1114778965 14:25516946-25516968 GGGAACCCAGGACCAGCAGGTGG + Intergenic
1118961778 14:70539889-70539911 AGCACCATGGGACCAGAAGGCGG + Intergenic
1119883461 14:78120952-78120974 GGCACCACAGGAACTCACGGGGG - Intergenic
1120268978 14:82286303-82286325 GGCATCACGGAACCAGAAGGCGG + Intergenic
1121420450 14:93809368-93809390 GGCATTGCAGGACCAGAAGGCGG - Intergenic
1121758359 14:96422042-96422064 GGCACCACGGGACCAGAAGGCGG - Intronic
1122243385 14:100383848-100383870 GACACCTCATGACCAGAAGAGGG + Intronic
1122261559 14:100526229-100526251 GGCACAAGAAGAGCAGAAGGAGG - Intronic
1123208142 14:106733577-106733599 GGCACCATGGGACCAGAAGGCGG + Intergenic
1125381494 15:39091837-39091859 GGAACCACAGGACCCTAAAGAGG + Intergenic
1125510261 15:40288906-40288928 GTCTCCACAGTTCCAGAAGGAGG - Exonic
1125518036 15:40333849-40333871 GCCATGGCAGGACCAGAAGGAGG + Exonic
1127964877 15:63916020-63916042 TGGACCACAAGGCCAGAAGGCGG - Intronic
1129800060 15:78406719-78406741 GGAACCACAGGGCCTCAAGGAGG - Intergenic
1132665875 16:1081120-1081142 GGCGCCCCAGGCCCAGAACGTGG + Intergenic
1135321737 16:21502069-21502091 CGCAGCACAGGACGAGGAGGCGG + Intergenic
1135437230 16:22437196-22437218 CGCAGCACAGGACGAGGAGGCGG - Intergenic
1137334220 16:47532710-47532732 GGAACCACAGGACCCCAAAGAGG + Intronic
1138903487 16:61302431-61302453 GCCACCTCAGCATCAGAAGGTGG + Intergenic
1139421754 16:66853482-66853504 GGCAGCTCAGGCCCGGAAGGAGG - Exonic
1139820209 16:69715114-69715136 GGCTCCCCAAGCCCAGAAGGTGG + Intronic
1139840461 16:69874289-69874311 AGCAGCGCAGGACCAGAGGGGGG + Intronic
1141199959 16:81890062-81890084 GGGGCCACAGGACCAGTGGGCGG + Intronic
1142007011 16:87694141-87694163 GGCAGAACTGGACCAGGAGGAGG + Intronic
1142165754 16:88586728-88586750 AGCACCACAGCCCCAGAAGGTGG - Intronic
1142257807 16:89023749-89023771 GGAACCCCAGGTCCAGAATGGGG - Intergenic
1143162786 17:4882168-4882190 TGCCCAACAGGTCCAGAAGGGGG - Intronic
1143470264 17:7169608-7169630 GGCATCACAGGACCAAAAGGCGG + Intergenic
1144761417 17:17709628-17709650 GGGAGCTCAGGACCAGAATGAGG - Intronic
1145101400 17:20080760-20080782 GGAGCCCCAGGACAAGAAGGCGG + Intronic
1146747165 17:35342106-35342128 GGCATCACAAGACCAGAAGGCGG + Intergenic
1146826695 17:36029250-36029272 GGCAGGTCAGGACCAGATGGTGG + Intergenic
1147539097 17:41341949-41341971 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1147754999 17:42761881-42761903 GGCACACCAGGGTCAGAAGGTGG + Exonic
1147992160 17:44341154-44341176 AGCATCGCAGGACCAGAAGGCGG + Intergenic
1148712915 17:49694921-49694943 GCCATCACAGGACCCAAAGGAGG + Intergenic
1148821219 17:50360763-50360785 AGCACCACAGGCCCAGAATGGGG - Exonic
1149165624 17:53748792-53748814 GGCATCACAGGACCAGAAGGCGG + Intergenic
1149384341 17:56126696-56126718 GGCTCTCCAGGACCAAAAGGGGG + Intronic
1150529272 17:65959616-65959638 GGAACCACAGGAACCCAAGGAGG - Intronic
1151476778 17:74348699-74348721 GGCAAGACAGGAACAGGAGGTGG + Intronic
1152061848 17:78082197-78082219 GGCATCACAGGATCAGAAGGCGG - Intronic
1152772429 17:82178554-82178576 GGCGCTACAGGAGCAGGAGGTGG - Exonic
1153084373 18:1267111-1267133 GGGACCACAGGACCTGTACGTGG - Intergenic
1154478844 18:14796746-14796768 GGCACTACGGGACGACAAGGTGG - Intronic
1154478994 18:14798182-14798204 GGCACCACGGGACGACAAGGCGG - Intronic
1157449207 18:47772806-47772828 TGCACCCCACCACCAGAAGGCGG + Intergenic
1157823533 18:50791458-50791480 GCCAGGGCAGGACCAGAAGGGGG + Intergenic
1159118775 18:64145423-64145445 GGCACCATGGGACCAGAAGGCGG + Intergenic
1159376197 18:67596744-67596766 GGGGCCACAGGACCAGTTGGTGG + Intergenic
1159975601 18:74707817-74707839 GGCAGCACAGCACCAGATGTAGG - Intronic
1161138853 19:2636422-2636444 GGCACCCCAGGGCCTGATGGTGG + Intronic
1161908793 19:7177192-7177214 GCCCCCACAGGAATAGAAGGTGG - Intronic
1162289003 19:9764607-9764629 GGCACTGTGGGACCAGAAGGCGG + Intronic
1163309424 19:16504302-16504324 GGCACCACAGAACCTTAGGGTGG - Intronic
1163791704 19:19310253-19310275 GGCACCAGAGGACGAGGATGAGG + Intronic
1163961058 19:20693168-20693190 AGCATGGCAGGACCAGAAGGCGG + Intronic
1164836023 19:31355497-31355519 TGACTCACAGGACCAGAAGGTGG - Intergenic
1165266502 19:34666502-34666524 TGCACCACCGGACAGGAAGGGGG + Intronic
1165484844 19:36089368-36089390 GGGACCAGAGGAACAGAGGGAGG - Intronic
1165566819 19:36736750-36736772 GGCACCGCGGGACCAGAAGGTGG + Intronic
1166443191 19:42834144-42834166 AGCATCGCAGGACCAGAAGGCGG - Intronic
1166450979 19:42900547-42900569 AGCATCGCAGGACCAGAAGGCGG - Intronic
1166462887 19:43004892-43004914 AGCATTGCAGGACCAGAAGGCGG - Intronic
1166480160 19:43164870-43164892 AGCATCGCAGGATCAGAAGGCGG - Intronic
1166755087 19:45185709-45185731 GGCCACACAGGGCCAGAATGAGG + Intronic
1166773829 19:45300459-45300481 GGCAGCTCAGGGCCAGCAGGAGG + Intronic
1168136693 19:54356518-54356540 GGCAGAAGAGGACCAGGAGGAGG + Exonic
1168693992 19:58394930-58394952 GGCACCCCAGGGCTAGCAGGTGG + Intergenic
925192069 2:1892821-1892843 GTCCCCACAGGCCCAGAAGGTGG - Intronic
925784779 2:7421366-7421388 TGCACCAGAGAACCAGAAAGAGG + Intergenic
927198005 2:20561198-20561220 GGCACCACAGGAGAAGACTGGGG - Intronic
927266801 2:21161457-21161479 GGAACCACAGGGCCACAAAGAGG + Intergenic
927655788 2:24944765-24944787 GGGAACAGAGGAACAGAAGGAGG + Exonic
932666232 2:73701077-73701099 GGAACCACAGGGCAGGAAGGAGG + Intergenic
932824620 2:74928007-74928029 GGCATCACAGGCCCAAGAGGAGG + Intergenic
934220396 2:90076899-90076921 GGCACCAAAGGAGAAGAAGATGG - Intergenic
934513739 2:94970555-94970577 GGTAGCAGATGACCAGAAGGAGG - Intergenic
934747693 2:96770378-96770400 GGCCCTACAGGATCAGCAGGGGG + Intronic
935248314 2:101238560-101238582 GGCATTGCGGGACCAGAAGGCGG + Intronic
935248974 2:101244954-101244976 GGCATCGCGGGACCAGAAGGCGG + Intronic
936835562 2:116705674-116705696 GTCACCACAGGAACAGAAATAGG + Intergenic
937543816 2:122990096-122990118 GGAACCACAGGGCCACAAAGAGG - Intergenic
939268924 2:139912766-139912788 GGCACCACAGGACCAGAAGGCGG - Intergenic
941009130 2:160278540-160278562 GGCAGCACCGGAACAGTAGGTGG - Exonic
941894817 2:170618654-170618676 GGCACCATGGGACCAGAAGGCGG - Intronic
941903410 2:170698818-170698840 CACACCCCAGGACCAGGAGGGGG - Intergenic
943232781 2:185276499-185276521 GGCATTGCAGGACCAGAAGGAGG + Intergenic
943846523 2:192656044-192656066 GTCACCACAGGAGCTGAAGAGGG + Intergenic
944618343 2:201485157-201485179 GGGACCACAGAAGCAGAAGTTGG - Intergenic
945325929 2:208482341-208482363 GGCACTGTGGGACCAGAAGGCGG - Intronic
945488891 2:210431040-210431062 GGCACCGCAGAACCAGAAGGCGG + Intergenic
947039147 2:225895465-225895487 GACAGCAGAGGACCAGAAAGGGG - Intergenic
947303307 2:228714712-228714734 GGCACCATAGGACCAGAAGGTGG - Intergenic
947355392 2:229289456-229289478 AGCACCGCGGGACCAGAAGGTGG + Intergenic
947542784 2:230990356-230990378 GGCACCCCAGGAGAGGAAGGCGG + Intergenic
948314418 2:237016141-237016163 GGCCACAGAGGACAAGAAGGAGG + Intergenic
948756076 2:240160408-240160430 GACCGCACAGGACCACAAGGCGG - Intergenic
948756115 2:240160600-240160622 GGCTGCACAGGACCACAAGGTGG - Intergenic
1169235347 20:3925880-3925902 GGCACCTCACAACCTGAAGGTGG - Intronic
1169656912 20:7934447-7934469 GTCACCACAGGGACAGAAGGAGG - Intronic
1171395512 20:24830335-24830357 GACAGCACAGAACCAGAAAGGGG + Intergenic
1174271640 20:49373686-49373708 GGCAGCACAGCCCCAGAAGTGGG - Exonic
1174339480 20:49886943-49886965 GCCACCGCAGGTCCTGAAGGAGG - Intronic
1175871581 20:62211817-62211839 GGCACCCCAGAACCAGCACGAGG + Intergenic
1179797338 21:43793026-43793048 GGAACCTCAGGACCATCAGGCGG - Intronic
1179825991 21:43966837-43966859 GGCCCCACAGAACCAGGACGCGG - Intronic
1182787722 22:32921507-32921529 GGCTCAACAGGACCAGAGGCTGG + Intronic
1183315926 22:37136743-37136765 GTCTCCACAGGACCAGAAAGTGG + Intronic
1184286982 22:43477414-43477436 GGCACCACAGCAGCAGACGCAGG - Intronic
1185110774 22:48898989-48899011 GGGGCCACAGGACGAGAAGGCGG - Intergenic
1185125448 22:49008225-49008247 AGGACCACAGTCCCAGAAGGAGG - Intergenic
1185166865 22:49266784-49266806 AGCACCAGGGGAACAGAAGGAGG + Intergenic
949505556 3:4724461-4724483 CTCACCTCAGGGCCAGAAGGTGG - Intronic
951162438 3:19441095-19441117 GGCACCTCAGCAGCAGCAGGTGG + Intronic
951294875 3:20921552-20921574 GGCACCGCGGGACCAGAAGGCGG - Intergenic
952608096 3:35173807-35173829 GGCATTGCAGGACCAGAAGGCGG + Intergenic
953435461 3:42874192-42874214 GGTGCCACAGGACCAGAGGGAGG + Exonic
953701730 3:45201267-45201289 GCCACCACAGGTCTAGAAAGGGG + Intergenic
956556100 3:70524868-70524890 GGCACCACAAGGCCAGAATCAGG - Intergenic
959439752 3:106360763-106360785 GGCATCGCGGGACCAGAATGTGG - Intergenic
959811781 3:110628298-110628320 GGGGCCACAGGACCAGTTGGTGG - Intergenic
961637541 3:128342712-128342734 TGCACCACAGGACCAGCCGAGGG - Intronic
962212440 3:133490660-133490682 GGCTCCTCAGCACCAGAGGGTGG - Intergenic
963166315 3:142207698-142207720 GGCACCGCAGGACCAGAAGGCGG + Intronic
964004035 3:151808743-151808765 GGCACTGCAGGACCAGAAGGCGG - Intergenic
964996747 3:162891658-162891680 GGCACCCAAAGTCCAGAAGGGGG - Intergenic
965192419 3:165548750-165548772 GGCATCGCAGGACCAGAAGGCGG + Intergenic
966802352 3:183776007-183776029 GGCAGCACAGGAGGAGGAGGAGG + Exonic
966852957 3:184175731-184175753 GGCACCCGAGAACCAGAGGGGGG - Intronic
966888477 3:184389568-184389590 GGAACCACAGCTCCACAAGGGGG + Exonic
967590446 3:191267585-191267607 GGCACCATGGGACCAGAAGGTGG - Exonic
968632010 4:1656653-1656675 CGCACCACAGGCCCGGCAGGGGG + Intronic
968863761 4:3194441-3194463 GGCACCAGAGGCCCAGGAGGTGG + Intronic
969175027 4:5391981-5392003 GGCACCACAGGGCCATTAGGAGG + Intronic
975586493 4:75955319-75955341 AGCATCGCAGGACCAGAAGGCGG + Intronic
975619509 4:76281886-76281908 GGCACCGTGGGACCAGAAGGCGG - Intronic
975936868 4:79592042-79592064 GGCACCGCAGGACCAGAAGGCGG - Intergenic
976511024 4:85910204-85910226 GGTACCACAGGACCCCAAAGAGG + Intronic
976636445 4:87291133-87291155 GGCACCGCGGGACCAGAAGGCGG - Intergenic
976897444 4:90128363-90128385 GGCGCCAGAGGACAAGCAGGCGG - Intronic
977058080 4:92218480-92218502 GGCACCACGGGACCAGAAGACGG + Intergenic
977394636 4:96455219-96455241 GGGACCACTGGGCCAGAAGCTGG + Intergenic
977555060 4:98480024-98480046 GGCACTGCGTGACCAGAAGGCGG + Intronic
977630038 4:99232338-99232360 GGCACCACGGGACCAGATGGCGG + Intergenic
978544777 4:109859193-109859215 GGCACCGTGGGACCAGAAGGTGG - Intronic
978572048 4:110148464-110148486 GTTACCAGAGGCCCAGAAGGGGG + Intronic
979767629 4:124481496-124481518 GAGACCACAGGCCCAGAAAGAGG + Intergenic
980661435 4:135864078-135864100 GGCACCATGGGACCAGAAGGCGG - Intergenic
981420407 4:144543283-144543305 GACATCACGGGACCAGAAGGCGG + Intergenic
981849249 4:149209174-149209196 GCCTCCACAGAACCAGAAGCAGG - Intergenic
982846206 4:160255952-160255974 AGCATCGCGGGACCAGAAGGTGG - Intergenic
983526306 4:168763623-168763645 GGTACCACAGCAGCAGGAGGTGG + Intronic
983762609 4:171430765-171430787 GGTACCACAGGGCCTGGAGGCGG + Intergenic
985503481 5:264017-264039 GGGAACTCAGTACCAGAAGGAGG + Intergenic
988769850 5:34421487-34421509 GGCACCGTGGGACCAGAAGGTGG - Intergenic
988774769 5:34467772-34467794 GGCATTGCATGACCAGAAGGCGG - Intergenic
989482310 5:41946129-41946151 GGCACCATGGGACCAAAAGGTGG + Intergenic
989559434 5:42834394-42834416 GGCATCACAGGACCAGAAGGCGG - Intronic
991231911 5:64343667-64343689 AACACCACAGGACCAAATGGTGG + Intronic
992271979 5:75074125-75074147 GGCTCCTCAGTAGCAGAAGGCGG + Intronic
992734608 5:79706124-79706146 AGCATCGCAGGACCAGAAGGCGG - Intronic
992818692 5:80471578-80471600 GGCACCACGGGACCAGAAGGCGG + Intronic
994182065 5:96778482-96778504 GGTAGCCCAGGAGCAGAAGGAGG + Intronic
997401694 5:133608436-133608458 GACACCAGAAGACCAGAAGGTGG + Intronic
998729424 5:145057592-145057614 AGCACCAAAGGACAAGAGGGAGG - Intergenic
999682498 5:154073116-154073138 GGCACCGCGGGACCAAAAGGCGG - Intronic
999896764 5:156042686-156042708 GGGGCCACAGGACCAGCTGGTGG + Intronic
1001012283 5:168109207-168109229 GGCAGCAAAGGCCCAGAAGCAGG + Intronic
1001265697 5:170272982-170273004 GGCAGCACCAAACCAGAAGGAGG - Intronic
1002170828 5:177373285-177373307 GGCACCAAAGGTCTATAAGGGGG + Intergenic
1002285532 5:178160362-178160384 GGCACCCCAGGACCAGGAAGCGG - Intergenic
1006503388 6:34472704-34472726 GGCACCACAGGCCTGGGAGGAGG - Intronic
1006646054 6:35515010-35515032 GGCTCCACGAGACCAGCAGGTGG + Intergenic
1007288480 6:40765700-40765722 GGCATCACTGATCCAGAAGGAGG - Intergenic
1007722345 6:43892481-43892503 GGCCCCAGCAGACCAGAAGGTGG + Intergenic
1008272647 6:49507807-49507829 GGCACTGCAGGACCAGAAGGTGG - Intronic
1008592667 6:53009798-53009820 GGCACCAGAGGGCCAAGAGGTGG - Intronic
1012953954 6:105548493-105548515 GGCAGGACGGGACCAGAAGTCGG - Intergenic
1013181180 6:107718238-107718260 GCTACCACAGGAACAGAATGGGG - Intronic
1014405199 6:121042804-121042826 GGCATCATGGGACCAGAAGGCGG + Intergenic
1014405837 6:121049202-121049224 GGCATCACGGGACCAGAAGGCGG + Intergenic
1018763968 6:166915253-166915275 GGCACTGCAGGACCAGAAGGCGG - Intronic
1019538275 7:1539931-1539953 GGCCCCCCAGGTCAAGAAGGAGG + Exonic
1019693133 7:2428511-2428533 GGCATCGCAGGACCAGAAGGCGG - Intronic
1021097345 7:16548465-16548487 GGAACCACAGAACCCTAAGGAGG - Intronic
1022450471 7:30509158-30509180 GGCACCACGGGACCAGAAGATGG - Intronic
1023541835 7:41274430-41274452 AGCACCACAGGGCCAGTAGTGGG + Intergenic
1024026623 7:45414630-45414652 GGTTGCACAGGACAAGAAGGAGG + Intergenic
1024407714 7:49001770-49001792 GGCACCACAGGAGCAGGATGGGG - Intergenic
1024423129 7:49193417-49193439 GGCACCAGACCACCAGAAAGGGG - Intergenic
1025735608 7:64144068-64144090 GGCACTGCAGGACCAGAAGGCGG - Intronic
1026015763 7:66669477-66669499 GGCAGCAAAAGACAAGAAGGTGG + Intronic
1028327504 7:89545247-89545269 GGCACCATGTGACCAGAAGGCGG - Intergenic
1028707736 7:93869987-93870009 GGCACCGTGGGACCAGAAGGCGG - Intronic
1028816790 7:95156320-95156342 GGCACCACAGGACCCCAAAGAGG + Intronic
1029109496 7:98205360-98205382 TGCACCACAGGAACGGAAGCGGG - Intronic
1029445926 7:100612803-100612825 GGCGCCCCAGGACCAGGAGCTGG + Exonic
1029464823 7:100718900-100718922 GACACCACGGGACCAGAAGGCGG + Intergenic
1030153531 7:106429057-106429079 GGCACCTCAGGGCAAGAAGCAGG - Intergenic
1031895258 7:127340620-127340642 AGCACCCCAGGACCAAAGGGAGG - Intergenic
1032974452 7:137206314-137206336 GGCACCATGGGACCAGAAGGCGG + Intergenic
1033197740 7:139341700-139341722 GGGACCAAAGGACCAGCGGGGGG + Intronic
1033502192 7:141963107-141963129 GGCACCGCGGGAGCAGAAAGCGG + Intronic
1034119082 7:148610917-148610939 GGGGCCACAGAACAAGAAGGTGG - Intronic
1034335976 7:150323632-150323654 GGCACCGCTGGCCCAGCAGGTGG - Intronic
1034777504 7:153843519-153843541 GGCATCTCAGGTCCAGGAGGTGG - Intergenic
1035546536 8:486023-486045 GGCAACACAGCAGCAAAAGGTGG + Intergenic
1036083946 8:5592153-5592175 GGCACCATAGGACGAGAAGGCGG + Intergenic
1037005000 8:13767438-13767460 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG + Intergenic
1039672551 8:39618262-39618284 GGCACCACAGGACCAGAAGGCGG - Intronic
1040277247 8:46020327-46020349 GGCATCACGGGACCAGAAGGTGG + Intergenic
1041296357 8:56361295-56361317 GGCACCTTGGGACCAGAAGCTGG + Intergenic
1042687760 8:71461491-71461513 GGAACCACAGGACCCCAAAGAGG + Intronic
1044252449 8:90019682-90019704 TCCATCACAGGACCAGAATGAGG - Intronic
1045621258 8:103980792-103980814 ACCACCACTGGACCACAAGGGGG - Intronic
1048422267 8:134288865-134288887 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1048431939 8:134378627-134378649 GGCACCATGGGACCAGAAGGCGG - Intergenic
1049658349 8:143808743-143808765 GGCTCCTCGGGCCCAGAAGGAGG - Exonic
1049850039 8:144826240-144826262 GGTAACACAGGAGCAGGAGGGGG - Intergenic
1050198164 9:3110447-3110469 GGCACCGTGGAACCAGAAGGCGG - Intergenic
1056913516 9:90725225-90725247 GGCCCCACAGCACAAGAGGGTGG - Intergenic
1058258248 9:102796752-102796774 AGCATCACAGGACCAGAAGGCGG + Intergenic
1058468656 9:105254441-105254463 GGCAACACCGGAACAAAAGGAGG + Intronic
1059114908 9:111592512-111592534 GGCACCACGGAACCAGAAGGCGG + Intronic
1060345195 9:122809799-122809821 GGCACCACGGGACCAGAAGGCGG + Intronic
1060435235 9:123587073-123587095 GGCACCGCAGGACCAGAAGCTGG - Intronic
1060470027 9:123940834-123940856 AGCAGCACAGGCCCAGAAGCAGG - Intergenic
1061009693 9:127947729-127947751 GGGAAGACAGGCCCAGAAGGTGG - Intronic
1061422027 9:130477777-130477799 GGCACCCAAGGACCAGGCGGGGG + Intronic
1061808140 9:133147873-133147895 GACACCCCAGGACCAGCAGAGGG - Intronic
1062231377 9:135483744-135483766 GGCAGCGCAGGATGAGAAGGGGG + Intronic
1062264156 9:135679225-135679247 GGCGCCTCAGGAACAGAAGGGGG - Intergenic
1062383166 9:136297489-136297511 GCCACCACTGGAGCAGCAGGTGG - Intronic
1062503669 9:136862036-136862058 GACACCCCAGGACAGGAAGGTGG + Intronic
1062516714 9:136940588-136940610 GGCCCCACAGGACCAGCCGAAGG + Exonic
1186672687 X:11783006-11783028 GGCCCCACAAAACCTGAAGGGGG + Intergenic
1187530324 X:20090710-20090732 GCAAACACAGGACCACAAGGTGG + Intronic
1188224491 X:27580404-27580426 GGGACAAAAGGAGCAGAAGGGGG - Intergenic
1189017282 X:37297320-37297342 GGCACCGCAGGACCAGAAGGCGG - Intergenic
1189397368 X:40634986-40635008 GAAGCCACAGGATCAGAAGGGGG + Intronic
1189637622 X:43028162-43028184 GGCACCATGGAACCAGAAGGTGG - Intergenic
1190034969 X:47013688-47013710 GGCAAAACAGGACCGTAAGGTGG + Intronic
1190360481 X:49644418-49644440 GGAACCACAGGACCTCAAAGAGG + Intergenic
1191238058 X:58152273-58152295 GACACCACGGGACCAGAAGGCGG - Intergenic
1192849802 X:74942799-74942821 GGAACCACTGGGCCAGAAGCTGG + Intergenic
1192950503 X:76011368-76011390 AGCATCATGGGACCAGAAGGTGG + Intergenic
1193442594 X:81561408-81561430 GGCATCATAGGACCAGAAGGCGG + Intergenic
1193565497 X:83071155-83071177 GGCACCACGGGACCAGAAGGCGG + Intergenic
1194192508 X:90855215-90855237 GGCACCACGGGACCAGAAGGTGG + Intergenic
1196186353 X:112748721-112748743 GAAACCACAGAAACAGAAGGTGG + Intergenic
1198267689 X:135024578-135024600 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1199427170 X:147716232-147716254 GTCACCAGAGGGCCAGATGGAGG + Intergenic
1199602796 X:149552626-149552648 GGCACCGTGGGAGCAGAAGGCGG - Intergenic
1199647593 X:149926849-149926871 GGCACCGTGGGAGCAGAAGGCGG + Intergenic
1199685050 X:150258216-150258238 GGCACCAGAGGGCCAGGAAGGGG - Intergenic
1200539140 Y:4437659-4437681 GGCACCACGGGACCAGAAGGTGG + Intergenic
1200857291 Y:7952684-7952706 GACATCACAGAACCAGAATGTGG - Intergenic
1200858147 Y:7961119-7961141 AGCATCACAGGACCAGAAGACGG - Intergenic
1201622290 Y:15973467-15973489 GGCACCATGGGACCAGAAGGCGG - Intergenic
1201623125 Y:15981915-15981937 GGCACTGTGGGACCAGAAGGCGG - Intergenic
1202177411 Y:22110461-22110483 GGCACCACAGGACCAGAAAGCGG - Intergenic
1202213950 Y:22475923-22475945 GGCACCACAGGACCAGAAAGCGG + Intergenic