ID: 1038676844

View in Genome Browser
Species Human (GRCh38)
Location 8:29630505-29630527
Sequence CTCCAGAGTGTCCCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038676844_1038676848 -3 Left 1038676844 8:29630505-29630527 CCTCCTACAGGGACACTCTGGAG No data
Right 1038676848 8:29630525-29630547 GAGCTGCTGCTTTAGGATCTGGG No data
1038676844_1038676846 -10 Left 1038676844 8:29630505-29630527 CCTCCTACAGGGACACTCTGGAG No data
Right 1038676846 8:29630518-29630540 CACTCTGGAGCTGCTGCTTTAGG No data
1038676844_1038676847 -4 Left 1038676844 8:29630505-29630527 CCTCCTACAGGGACACTCTGGAG No data
Right 1038676847 8:29630524-29630546 GGAGCTGCTGCTTTAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038676844 Original CRISPR CTCCAGAGTGTCCCTGTAGG AGG (reversed) Intergenic
No off target data available for this crispr