ID: 1038681777

View in Genome Browser
Species Human (GRCh38)
Location 8:29675199-29675221
Sequence CTGTGTTTGAAGAAATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038681777_1038681778 -5 Left 1038681777 8:29675199-29675221 CCAGGAAATTTCTTCAAACACAG No data
Right 1038681778 8:29675217-29675239 CACAGATTTCCTTGAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038681777 Original CRISPR CTGTGTTTGAAGAAATTTCC TGG (reversed) Intergenic
No off target data available for this crispr