ID: 1038686294

View in Genome Browser
Species Human (GRCh38)
Location 8:29721714-29721736
Sequence CTCAATGCTGCAGTCTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038686294_1038686299 -9 Left 1038686294 8:29721714-29721736 CCACCCTAGACTGCAGCATTGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1038686299 8:29721728-29721750 AGCATTGAGCACCCCAGGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 182
1038686294_1038686304 26 Left 1038686294 8:29721714-29721736 CCACCCTAGACTGCAGCATTGAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1038686304 8:29721763-29721785 CCCCCTCATTTTCTCAGTTGAGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038686294 Original CRISPR CTCAATGCTGCAGTCTAGGG TGG (reversed) Intergenic
900567541 1:3340998-3341020 CTGAAGGCTCCAGGCTAGGGAGG + Intronic
900821326 1:4891238-4891260 CTCAATGCAGCAGTATTGAGAGG - Intergenic
902991582 1:20191265-20191287 TTCAATGCTGCAGTGTCGGTAGG - Exonic
903067378 1:20708154-20708176 CTCAATACTGCAGCTCAGGGAGG - Intronic
903996797 1:27310441-27310463 CTCAATCCTGTAGGCAAGGGAGG + Intergenic
907676656 1:56523952-56523974 CTCAAGGTTACAGTCTAGGGAGG - Intronic
908264714 1:62366960-62366982 CTCAATGCAACAGTGTTGGGAGG + Intergenic
908416883 1:63921830-63921852 CTCACTTCTGCAGTCCTGGGTGG - Intronic
917076644 1:171213040-171213062 CTCCATGCAGCAGTGTTGGGAGG + Intergenic
922975232 1:229778650-229778672 CTCAATGCTGCAGCAGAGGAGGG + Intergenic
923096828 1:230781839-230781861 CTCAATTATGAAGTCTAGTGGGG + Intronic
1065498628 10:26355828-26355850 CTGAATGCTGCATTCTGTGGAGG + Intergenic
1067306280 10:45067108-45067130 CTCAATGTAGCAGTATTGGGAGG - Intergenic
1071036673 10:81255819-81255841 CCCAATGCAACAGTCTTGGGAGG - Intergenic
1071880278 10:89889674-89889696 CTCAATGTGGCAGTGTGGGGAGG + Intergenic
1072751373 10:97982239-97982261 CTCTATGATGCGGTCTAGGCAGG + Intronic
1072984678 10:100129408-100129430 ATCAAAGCTGCAGTCTGGGCTGG - Intergenic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1076610550 10:131723415-131723437 CTCATGGCTGCAGGCTAGGATGG + Intergenic
1078360599 11:10664769-10664791 CTCAAGGCTGCAGTTAAGGATGG - Intronic
1079842510 11:25421686-25421708 CCCAAACCTGCAGTGTAGGGAGG + Intergenic
1086085420 11:82949315-82949337 CTCGATGCAGAAGTCTAGGTTGG + Intronic
1087635002 11:100692086-100692108 CAAGATGCTGCAGGCTAGGGTGG - Intronic
1087988630 11:104718002-104718024 CTCAATGTTGCAGTATTGGGAGG - Intergenic
1088915623 11:114225664-114225686 CTTAATGCAGCAGTGTTGGGAGG - Intronic
1089913345 11:122126217-122126239 CTCACTTCTGCATTCTAGGCTGG - Intergenic
1091806069 12:3356896-3356918 CCCAGTGCTCCAGGCTAGGGAGG + Intergenic
1092680092 12:10969244-10969266 CTCAATGTTGTAGACTATGGTGG - Intronic
1094386290 12:29897134-29897156 CTCAATGCTGTGGTGTTGGGAGG - Intergenic
1094705792 12:32913320-32913342 CACACTGCTGCAGTCTAGCTTGG - Intergenic
1096356259 12:50943412-50943434 CTTAATTCTGCAGTTTAGGCCGG + Intergenic
1096607922 12:52780067-52780089 CTCAGTACTGCAGCCAAGGGAGG - Intergenic
1096943986 12:55383702-55383724 CTCACTGCTGCATTCTAGCCTGG - Intergenic
1097048828 12:56208292-56208314 CTCCAGGCTGCAGACCAGGGTGG + Exonic
1097475264 12:60047404-60047426 CTCTATGCTGGAGTCTAGAAAGG + Intergenic
1098115457 12:67171757-67171779 CCCAATGCAGCAGTGTTGGGAGG + Intergenic
1098188537 12:67923949-67923971 CTCAGTGCTGGAATCTAGAGAGG - Intergenic
1100191520 12:92198083-92198105 TACAATACTGAAGTCTAGGGAGG + Intergenic
1102134987 12:110566638-110566660 CTGATTGCTGCAGTCTAGGCTGG - Intronic
1104059333 12:125254419-125254441 CTGAAGTCTGCAGTCTAAGGGGG - Intronic
1104467441 12:129002341-129002363 GGCAAGGCTGCAGTCAAGGGAGG + Intergenic
1104905848 12:132213013-132213035 CTCAAGGCTGTAGACTCGGGTGG - Intronic
1108365677 13:49709687-49709709 CTGAGGGCTGCTGTCTAGGGTGG + Exonic
1112043989 13:95576750-95576772 CTAATCGCTGCAGTCTAGTGGGG - Intronic
1112782196 13:102913146-102913168 CTCCATGATGTAGTCTAGGATGG + Intergenic
1114795437 14:25710241-25710263 CTCAATGCTACAGTGTTGAGAGG - Intergenic
1114857482 14:26466689-26466711 CTCAATGCAACAGTTTTGGGAGG + Intronic
1117202500 14:53406642-53406664 CCCAATGCAGCAGTGTTGGGAGG + Intergenic
1119529103 14:75347081-75347103 CTCAATGCAACAGTGTTGGGAGG + Intergenic
1119935521 14:78589185-78589207 CTCACTGCTGAAGTCTAGAAAGG - Intronic
1123025214 14:105420769-105420791 CTCAAAGCTGCAGGCCCGGGGGG - Intronic
1125586673 15:40825591-40825613 CCCACTGCTGCTGTCTAAGGTGG + Intronic
1126524943 15:49642879-49642901 CACACTGCTGCAGTCTAGCCTGG + Intronic
1126765222 15:52004810-52004832 CCCAATGCAGCAGTGTTGGGAGG - Intronic
1128635419 15:69299303-69299325 CTCTCTGCTGCAATCGAGGGCGG + Intronic
1130893497 15:88152617-88152639 CTCAATGCCACAGTCTGGGTGGG - Intronic
1133800481 16:9081137-9081159 CTCAATGTGGCAGTGTTGGGAGG + Intergenic
1137410476 16:48223619-48223641 CCCATTGGTGCAGTCTAGGCTGG + Intronic
1139619131 16:68122814-68122836 CTCAATGCTTCTGTCCATGGTGG + Exonic
1139925161 16:70481914-70481936 CTCTATGCTGGAGTCTTAGGTGG + Intronic
1141753683 16:85976961-85976983 CTCAATGTTGCAGACAATGGAGG - Intergenic
1142720263 17:1771226-1771248 CTCCATGCTGCAGGCTGGGGGGG + Intronic
1143083647 17:4399667-4399689 CTCAATGCAACAGTGTTGGGAGG + Intergenic
1144767518 17:17740673-17740695 CTGAAAGCTGAAGTCCAGGGAGG - Intronic
1147512410 17:41082220-41082242 CTCAATGCAGCAGTGTTGGGAGG + Intergenic
1147514579 17:41103397-41103419 CTCAATGCCGCAGTGTTGGGAGG + Intronic
1147890217 17:43711645-43711667 CTCCATGGTGCAGTCATGGGAGG + Intergenic
1148653488 17:49266373-49266395 CCCTATGCAGCAGTCTAGGAAGG + Intergenic
1150495366 17:65603945-65603967 CCCAATGCAGCAGTGTTGGGAGG - Intronic
1152228139 17:79102104-79102126 CTCAATGCTGCAGAGTACAGAGG + Intronic
1152934521 17:83128284-83128306 CTCAAGGGTGCATTCTATGGGGG - Intergenic
1157019952 18:43769094-43769116 CTCACTGGTTCAGTCTTGGGAGG - Intergenic
1158152502 18:54388400-54388422 CTTAATGCTGCATTCTTTGGAGG + Intergenic
1159743793 18:72207546-72207568 CGCAATACAGCAGACTAGGGAGG - Intergenic
1159892506 18:73965883-73965905 CTCAATGCTGCAGTATCAGTAGG - Intergenic
1165922369 19:39307290-39307312 CTCAGTGCTGCAGTGTCAGGGGG + Exonic
1167180665 19:47900869-47900891 CTCAATGCTGCAGTGAGGTGAGG + Intergenic
928897936 2:36285965-36285987 CTCCATGATGCAGTCTGGTGAGG + Intergenic
929114734 2:38434584-38434606 CTCAATGCAACAGTGTTGGGAGG + Intergenic
935346034 2:102109422-102109444 CCCAAAGCTGCAGGCTAGTGAGG + Intronic
935377657 2:102416597-102416619 CACAATGCTGCAATCTGGGTTGG + Intergenic
935650626 2:105378893-105378915 CTCCCTGCTGCAGTACAGGGTGG + Intronic
937675902 2:124589920-124589942 CTTAATGCAGCAGTGTTGGGAGG + Intronic
937888858 2:126919906-126919928 CCCAATGCAGCAGTATTGGGAGG + Intergenic
938593212 2:132760533-132760555 CTCAGTTCTGCAGTCTTTGGAGG + Intronic
941727627 2:168880759-168880781 TTCAATACTGGAGACTAGGGAGG + Intronic
942801795 2:179884034-179884056 CCCAGTGCTGCAGTCTTGAGGGG - Intergenic
944429007 2:199613333-199613355 CTCAATGCAGCAGTGTTGAGAGG - Intergenic
944693283 2:202177767-202177789 TTCAATGCAGCAGTGTTGGGAGG - Intronic
945063216 2:205926144-205926166 CTCAAATCTTCAGTCTAGTGTGG + Intergenic
945432186 2:209777327-209777349 CTCATTGTTGCAGTCCTGGGGGG - Exonic
946174381 2:217913518-217913540 TTCAAGGCTGCAGGCAAGGGTGG - Intronic
947016792 2:225629860-225629882 CCCAATGCAGCAGTGTTGGGAGG - Intronic
947196226 2:227570668-227570690 CTCAATGCTGCAGTTTAGGTTGG - Intergenic
948052876 2:234991825-234991847 CTCAGTGCTGGAGTGGAGGGAGG - Intronic
1170765126 20:19283298-19283320 AAGAATGCTGCAGTCTGGGGTGG - Intronic
1171401941 20:24879380-24879402 CTCATTGCTGCAGTTTTGTGAGG - Intergenic
1172175341 20:32968960-32968982 CTCAATGCTGCAGTTCTTGGAGG + Intergenic
1173292722 20:41728622-41728644 CTCAATGCAGCAGTGTTGGGAGG + Intergenic
1173676111 20:44837089-44837111 CTCACTGCTTCACTCTGGGGAGG - Intergenic
1174316382 20:49705582-49705604 CTCACCGCAGCAGTCTGGGGAGG + Intronic
1176991926 21:15507612-15507634 CTCAATGCAACAGTGTTGGGAGG + Intergenic
1180661251 22:17469264-17469286 CCCAATGCAACAGTGTAGGGAGG - Intronic
1180677316 22:17596268-17596290 CTCAATGTGGCAGTGTTGGGAGG + Intronic
1181810755 22:25402661-25402683 CTCACTGCTGCAGCCCTGGGGGG - Intronic
1181975727 22:26728034-26728056 CCCAATGCAGCAGTTTTGGGAGG - Intergenic
1184187112 22:42872202-42872224 CTCAAGGAGGCAGACTAGGGTGG + Intronic
950227097 3:11244794-11244816 CTGAAAGCTGCACTCTTGGGTGG + Intronic
950896618 3:16457819-16457841 CTCAACGCAGCAGTGAAGGGAGG + Intronic
951757935 3:26112693-26112715 CTGAATGCTGGAGTCTACTGGGG + Intergenic
953535087 3:43771127-43771149 CTCAATGCAGCTGTGTAGTGGGG - Intergenic
955727007 3:61943863-61943885 CTCTATTCTTCAGACTAGGGAGG - Intronic
957496052 3:80992490-80992512 CTCAATGCAACAGTATTGGGAGG - Intergenic
958458516 3:94364370-94364392 CTCAATGCAACAGTGTTGGGAGG + Intergenic
961281985 3:125771330-125771352 ATCCATTCTGCAGTCTAGGTGGG - Intergenic
962526933 3:136245394-136245416 CACAATGCTGCACTCTAGCCTGG + Intergenic
963137574 3:141921523-141921545 CTGAGTGCTGCATTCTAGGTTGG + Intronic
965762119 3:172090346-172090368 CTCAACTCTGCACTCTAGGCAGG + Intronic
966016269 3:175141336-175141358 ACCACTGTTGCAGTCTAGGGTGG + Intronic
966227764 3:177616512-177616534 CTCAATGCAACAGTCTTGGAAGG + Intergenic
966393899 3:179481351-179481373 CACAATGCTGCACTCTAGCCTGG - Intergenic
968926726 4:3552202-3552224 CTCAATGCAACAGTGTTGGGAGG + Intergenic
969256444 4:6005314-6005336 CTCAAGGCTGCACTCTAGGCTGG - Intergenic
969283542 4:6188294-6188316 CTCATTGCTTCAGACTAAGGTGG + Intronic
971372396 4:26029233-26029255 CTCACTGCGGCAGAGTAGGGAGG - Intergenic
971420585 4:26470560-26470582 CTCAATGCTGCAGTGTTGGTAGG - Intergenic
972265875 4:37459083-37459105 CATAATGCTGCAGTGAAGGGTGG + Intronic
973280558 4:48356616-48356638 CTGATTGATGCAGTCTAGGTTGG + Intronic
977691268 4:99914194-99914216 CTCAATGTGGCAGTGTTGGGAGG - Intronic
981866163 4:149422076-149422098 CACTATGCTGCAGTCTTGGTGGG + Intergenic
982286954 4:153745879-153745901 CTCAATGCAACAGTGTTGGGAGG - Intronic
983208673 4:164936460-164936482 TTCAATGCTGCAGCCTCTGGAGG - Intergenic
985270606 4:188191390-188191412 GTCAAAGCTGCTGTCTAGGCCGG + Intergenic
991860877 5:71011952-71011974 CTCATTGCTGCAGTATTGGAGGG - Intronic
992356110 5:75985333-75985355 CCCAATGCAGCAGTGTTGGGAGG - Intergenic
992413547 5:76531561-76531583 CCCAATGCAGCAGTGTTGGGAGG - Intronic
992612823 5:78522177-78522199 CTCACAGCTGTAATCTAGGGAGG + Intronic
994764743 5:103901828-103901850 CTCAATGCAACAGTCTTGGGAGG + Intergenic
996640412 5:125744666-125744688 CTCAATGCAACAGTGTTGGGAGG + Intergenic
997647719 5:135492013-135492035 CTTAGTGAGGCAGTCTAGGGCGG + Intergenic
999453418 5:151695378-151695400 CTCAATGCAGCAGTGTTGGGAGG - Intergenic
1003105592 6:3212671-3212693 TTCCATGCTGCAGTGCAGGGAGG + Intergenic
1003179604 6:3780497-3780519 CTCAAGGCTGCAGCCTTGGGTGG + Intergenic
1003538397 6:6996469-6996491 CCCAATGCAGCAGTGTTGGGAGG + Intergenic
1004499998 6:16200781-16200803 CTCAATGGTGCACTTCAGGGAGG + Intergenic
1004748380 6:18535935-18535957 CTCACTGCTGCAGTCAAGGAAGG + Intergenic
1004905875 6:20236518-20236540 CTCAAGGCTGCTGTCTGCGGTGG - Intergenic
1006196115 6:32243570-32243592 CTCAGGGCTGCTGTCCAGGGGGG + Intergenic
1006419075 6:33922199-33922221 CCCAGTGCTGCAGTATTGGGAGG + Intergenic
1007037494 6:38689868-38689890 CTCACTGCTGCACTCTAGCCTGG - Intronic
1008370888 6:50728987-50729009 CTCAATGCTTCACTCTTGGGAGG + Exonic
1009313433 6:62187440-62187462 TTCAATCTTACAGTCTAGGGAGG + Intronic
1013018920 6:106190414-106190436 CCCAATGCAGCAGTGTTGGGAGG - Intronic
1017565930 6:155686565-155686587 CTCAATGCAACAGTTTTGGGAGG + Intergenic
1019176884 6:170164523-170164545 ACCAATGCTGGAGTCTAGGATGG - Intergenic
1020382032 7:7557378-7557400 CTGTGTGCTGCAGGCTAGGGTGG - Intergenic
1022958986 7:35407626-35407648 CTAAAGGCTGCGGTCTATGGGGG - Intergenic
1025944508 7:66095499-66095521 CACCTTGCTGCAGTCAAGGGAGG + Intronic
1026403854 7:70043986-70044008 CTCATAGCTCCAGTCTAGAGAGG - Intronic
1028868857 7:95743541-95743563 ATAAATGATGCAGTCTCGGGAGG + Intergenic
1031840873 7:126737796-126737818 CAAAAAGCTGTAGTCTAGGGTGG + Intronic
1035348467 7:158225573-158225595 CTCAAGTTTGCAGTCTAGTGTGG + Intronic
1036937261 8:13015330-13015352 CTAAATGCTGAAGGTTAGGGAGG - Intronic
1036937462 8:13017206-13017228 CTGAATGCTGAAGTTTAGAGAGG + Intronic
1038213933 8:25544334-25544356 CCCAATGCAGCAGTCTTGGGAGG - Intergenic
1038686294 8:29721714-29721736 CTCAATGCTGCAGTCTAGGGTGG - Intergenic
1039887948 8:41665819-41665841 CTCCATGCTTCAGTTTTGGGAGG - Intronic
1040569081 8:48592316-48592338 GTGAAAGCTGCAGTGTAGGGTGG + Intergenic
1041299070 8:56391933-56391955 CTCCAAGAGGCAGTCTAGGGAGG + Intergenic
1041488987 8:58411114-58411136 GTCTATGCTGCCCTCTAGGGCGG + Intergenic
1042098756 8:65249099-65249121 CCCAATGCTTATGTCTAGGGAGG - Intergenic
1044892325 8:96850651-96850673 CTCACTGCTGCACTCTAGCCTGG - Intronic
1044904348 8:96984344-96984366 CTCAATGCAACAGTGTGGGGAGG + Intronic
1045175867 8:99724263-99724285 CTCAATCCTTCAGTCTAGCAGGG + Intronic
1046863297 8:119118466-119118488 CTTAATGTTGCAGTGTGGGGTGG - Intergenic
1047359143 8:124152063-124152085 CTCCACGCTGAAGTCTAAGGTGG - Intergenic
1047668029 8:127113884-127113906 CTCAATGCAGCTGTGTTGGGAGG + Intergenic
1047878403 8:129166395-129166417 CCCAATGCTACAGAGTAGGGGGG - Intergenic
1048486080 8:134848680-134848702 CTTAATGCTGCAGTCAGGGATGG - Intergenic
1048678618 8:136813236-136813258 CACACAGCTGCAGTCTAGGTGGG - Intergenic
1049718753 8:144105966-144105988 CTCAGTCCTGAAGTCTGGGGTGG - Exonic
1049790535 8:144470322-144470344 CGCAGTGCTGCAGTGTGGGGTGG - Intronic
1050679976 9:8099641-8099663 CTCAAGGCTGATGTCTAGGGTGG + Intergenic
1051718346 9:20008982-20009004 TTCAGTTCTGCAGTCTAAGGGGG - Intergenic
1051950002 9:22620117-22620139 CTCAATGCAGCAGTATTGAGAGG + Intergenic
1052189782 9:25646398-25646420 CTCAATGCAGCAGTATTGAGAGG - Intergenic
1053801643 9:41767584-41767606 CTCAATGCAACAGTGTTGGGAGG + Intergenic
1054143561 9:61547242-61547264 CTCAATGCAACAGTGTTGGGAGG - Intergenic
1054190075 9:61979738-61979760 CTCAATGCAACAGTGTTGGGAGG + Intergenic
1056371342 9:85957558-85957580 CCCAATGCGGCAGTGTTGGGAGG - Intronic
1056635815 9:88330417-88330439 CTCAATGCAGCAGCGTTGGGAGG - Intergenic
1059820705 9:117969216-117969238 CCCAATGCAACAGTGTAGGGAGG - Intergenic
1062312452 9:135946234-135946256 CCCGATGCTGCATTCCAGGGCGG - Intronic
1185715241 X:2336296-2336318 CTCACTACTGCAGTCTGGCGTGG - Intronic
1187926508 X:24255487-24255509 ATCATTGCTGAAGTCAAGGGAGG - Intergenic
1190074387 X:47305532-47305554 CCCAATGCAGCAGTGTTGGGAGG + Intergenic
1190272666 X:48878482-48878504 CCCAATGCAGCAGTGTTGGGAGG - Intergenic
1190690613 X:52910170-52910192 CTCAGTGCTGCAGTGTTGGGAGG + Intergenic
1190695370 X:52945622-52945644 CTCAGTGCTGCAGTGTTGGGAGG - Intronic
1192070818 X:67939515-67939537 CTCAATGCAACAGTGTTGGGAGG - Intergenic
1197158829 X:123300456-123300478 CTCCATGGTTCAGTCTTGGGAGG + Intronic
1197391298 X:125868912-125868934 CTCAATGAAGCAGTATTGGGAGG + Intergenic
1197769544 X:130081499-130081521 CTCAAGGCTGCATTCTGGGCTGG + Exonic
1197818680 X:130524282-130524304 CACAATGCTGCCTTCTAGGCTGG + Intergenic
1197871413 X:131065940-131065962 CTCTTTGCAGCAGTCTAGGCTGG + Intronic
1200842307 Y:7795262-7795284 CTCAATGCAACAGTGTTGGGTGG + Intergenic