ID: 1038687064

View in Genome Browser
Species Human (GRCh38)
Location 8:29728483-29728505
Sequence GTGCAGCTCCAGCACAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038687061_1038687064 10 Left 1038687061 8:29728450-29728472 CCACACTTGCTAAATGGGACACG No data
Right 1038687064 8:29728483-29728505 GTGCAGCTCCAGCACAGAAAAGG No data
1038687058_1038687064 27 Left 1038687058 8:29728433-29728455 CCAAATCAAAGAGCTCTCCACAC No data
Right 1038687064 8:29728483-29728505 GTGCAGCTCCAGCACAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038687064 Original CRISPR GTGCAGCTCCAGCACAGAAA AGG Intergenic
No off target data available for this crispr