ID: 1038691180

View in Genome Browser
Species Human (GRCh38)
Location 8:29764959-29764981
Sequence CCCTAGGAGCCCTCTCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038691174_1038691180 -8 Left 1038691174 8:29764944-29764966 CCATCCTCCTTCCACCCCTAGGA No data
Right 1038691180 8:29764959-29764981 CCCTAGGAGCCCTCTCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038691180 Original CRISPR CCCTAGGAGCCCTCTCTCAA TGG Intergenic
No off target data available for this crispr