ID: 1038692425

View in Genome Browser
Species Human (GRCh38)
Location 8:29775330-29775352
Sequence CTCAAGATGGGAAAGTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038692419_1038692425 9 Left 1038692419 8:29775298-29775320 CCTGAGGCAGCCAGATGGCACTG No data
Right 1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG No data
1038692421_1038692425 -1 Left 1038692421 8:29775308-29775330 CCAGATGGCACTGGCAGAGACAC No data
Right 1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038692425 Original CRISPR CTCAAGATGGGAAAGTCAAA GGG Intergenic
No off target data available for this crispr