ID: 1038699046

View in Genome Browser
Species Human (GRCh38)
Location 8:29832552-29832574
Sequence TGAAAGCCCTGTAGAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038699038_1038699046 21 Left 1038699038 8:29832508-29832530 CCTGGTCCTGGGTGATTAAAGCA No data
Right 1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG No data
1038699041_1038699046 15 Left 1038699041 8:29832514-29832536 CCTGGGTGATTAAAGCAAGGGAA No data
Right 1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG No data
1038699037_1038699046 28 Left 1038699037 8:29832501-29832523 CCTGTTACCTGGTCCTGGGTGAT No data
Right 1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038699046 Original CRISPR TGAAAGCCCTGTAGAGGAGG TGG Intergenic
No off target data available for this crispr