ID: 1038700974

View in Genome Browser
Species Human (GRCh38)
Location 8:29849012-29849034
Sequence GAACCCTGGGGGGAGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038700974_1038700985 24 Left 1038700974 8:29849012-29849034 CCCCAGGGCTCCCCCCAGGGTTC No data
Right 1038700985 8:29849059-29849081 GAGTCCGTGAAGAAAGAACTAGG No data
1038700974_1038700983 2 Left 1038700974 8:29849012-29849034 CCCCAGGGCTCCCCCCAGGGTTC No data
Right 1038700983 8:29849037-29849059 GACAAAGAAGAAGAAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038700974 Original CRISPR GAACCCTGGGGGGAGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr