ID: 1038701457

View in Genome Browser
Species Human (GRCh38)
Location 8:29853192-29853214
Sequence GGGGCATAACCTCATCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038701451_1038701457 1 Left 1038701451 8:29853168-29853190 CCAGTTCGGTAAATGTTAATGGC No data
Right 1038701457 8:29853192-29853214 GGGGCATAACCTCATCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038701457 Original CRISPR GGGGCATAACCTCATCCCTG GGG Intergenic
No off target data available for this crispr