ID: 1038702486

View in Genome Browser
Species Human (GRCh38)
Location 8:29861730-29861752
Sequence ATGCGGAAGGGGAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038702471_1038702486 22 Left 1038702471 8:29861685-29861707 CCACAGAAAGGTTTTTGGGGGAA No data
Right 1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038702486 Original CRISPR ATGCGGAAGGGGAAGTTGGG AGG Intergenic
No off target data available for this crispr