ID: 1038703254

View in Genome Browser
Species Human (GRCh38)
Location 8:29871017-29871039
Sequence TTATCCATCTACATGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038703247_1038703254 -6 Left 1038703247 8:29871000-29871022 CCCCAGAGCCCCAGAACTTATCC No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703245_1038703254 17 Left 1038703245 8:29870977-29870999 CCCAGTACATACATACTGTAGAG No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703248_1038703254 -7 Left 1038703248 8:29871001-29871023 CCCAGAGCCCCAGAACTTATCCA No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703243_1038703254 22 Left 1038703243 8:29870972-29870994 CCAGCCCCAGTACATACATACTG No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703249_1038703254 -8 Left 1038703249 8:29871002-29871024 CCAGAGCCCCAGAACTTATCCAT No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703246_1038703254 16 Left 1038703246 8:29870978-29871000 CCAGTACATACATACTGTAGAGC No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data
1038703244_1038703254 18 Left 1038703244 8:29870976-29870998 CCCCAGTACATACATACTGTAGA No data
Right 1038703254 8:29871017-29871039 TTATCCATCTACATGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038703254 Original CRISPR TTATCCATCTACATGAGTCA GGG Intergenic
No off target data available for this crispr