ID: 1038703670

View in Genome Browser
Species Human (GRCh38)
Location 8:29874462-29874484
Sequence GTTGTAATGATCCCAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038703667_1038703670 14 Left 1038703667 8:29874425-29874447 CCACTTAAGGAGTTTTTAGAACT No data
Right 1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG No data
1038703664_1038703670 25 Left 1038703664 8:29874414-29874436 CCGCGCCTGGCCCACTTAAGGAG No data
Right 1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG No data
1038703662_1038703670 28 Left 1038703662 8:29874411-29874433 CCACCGCGCCTGGCCCACTTAAG No data
Right 1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG No data
1038703665_1038703670 20 Left 1038703665 8:29874419-29874441 CCTGGCCCACTTAAGGAGTTTTT No data
Right 1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG No data
1038703666_1038703670 15 Left 1038703666 8:29874424-29874446 CCCACTTAAGGAGTTTTTAGAAC No data
Right 1038703670 8:29874462-29874484 GTTGTAATGATCCCAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038703670 Original CRISPR GTTGTAATGATCCCAGAATC TGG Intergenic
No off target data available for this crispr