ID: 1038703994

View in Genome Browser
Species Human (GRCh38)
Location 8:29877065-29877087
Sequence ATGGGTAGACAGCCCTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038703991_1038703994 -5 Left 1038703991 8:29877047-29877069 CCTCACAGGCTTGAAGTGATGGG No data
Right 1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG No data
1038703989_1038703994 -4 Left 1038703989 8:29877046-29877068 CCCTCACAGGCTTGAAGTGATGG No data
Right 1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG No data
1038703988_1038703994 7 Left 1038703988 8:29877035-29877057 CCTGGCAGAAACCCTCACAGGCT No data
Right 1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG No data
1038703986_1038703994 16 Left 1038703986 8:29877026-29877048 CCTTGTAATCCTGGCAGAAACCC No data
Right 1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG No data
1038703985_1038703994 20 Left 1038703985 8:29877022-29877044 CCTTCCTTGTAATCCTGGCAGAA No data
Right 1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038703994 Original CRISPR ATGGGTAGACAGCCCTGACA GGG Intergenic
No off target data available for this crispr