ID: 1038711188

View in Genome Browser
Species Human (GRCh38)
Location 8:29947543-29947565
Sequence CTGTGGAAGACCCTGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038711188_1038711194 30 Left 1038711188 8:29947543-29947565 CCCCCTCACAGGGTCTTCCACAG No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038711188 Original CRISPR CTGTGGAAGACCCTGTGAGG GGG (reversed) Intergenic
No off target data available for this crispr