ID: 1038711194

View in Genome Browser
Species Human (GRCh38)
Location 8:29947596-29947618
Sequence TTTACCAATTTTTCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038711188_1038711194 30 Left 1038711188 8:29947543-29947565 CCCCCTCACAGGGTCTTCCACAG No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data
1038711192_1038711194 13 Left 1038711192 8:29947560-29947582 CCACAGAGCAAAGTTTTCAATTC No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data
1038711189_1038711194 29 Left 1038711189 8:29947544-29947566 CCCCTCACAGGGTCTTCCACAGA No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data
1038711191_1038711194 27 Left 1038711191 8:29947546-29947568 CCTCACAGGGTCTTCCACAGAGC No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data
1038711190_1038711194 28 Left 1038711190 8:29947545-29947567 CCCTCACAGGGTCTTCCACAGAG No data
Right 1038711194 8:29947596-29947618 TTTACCAATTTTTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038711194 Original CRISPR TTTACCAATTTTTCTTTTTC TGG Intergenic
No off target data available for this crispr