ID: 1038711758

View in Genome Browser
Species Human (GRCh38)
Location 8:29953425-29953447
Sequence TCACATATGCATAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038711758_1038711763 -4 Left 1038711758 8:29953425-29953447 CCTTCCAGCTTATGCATATGTGA 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1038711763 8:29953444-29953466 GTGAGCCCTGGTGGGTTTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 246
1038711758_1038711768 20 Left 1038711758 8:29953425-29953447 CCTTCCAGCTTATGCATATGTGA 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1038711768 8:29953468-29953490 ACCTGGCACCCAGACTGCAATGG 0: 1
1: 0
2: 0
3: 20
4: 167
1038711758_1038711766 3 Left 1038711758 8:29953425-29953447 CCTTCCAGCTTATGCATATGTGA 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1038711766 8:29953451-29953473 CTGGTGGGTTTCCAGGCACCTGG 0: 1
1: 0
2: 1
3: 20
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038711758 Original CRISPR TCACATATGCATAAGCTGGA AGG (reversed) Intergenic
900006155 1:54169-54191 CCACAGATGCATAAGCTCCAGGG - Intergenic
905141497 1:35848907-35848929 TCACATATGCATTTGATGGAAGG + Intronic
912903837 1:113682070-113682092 TCAGAGAATCATAAGCTGGAAGG - Intronic
915021306 1:152782118-152782140 TCTGATATGAATAAACTGGATGG + Intronic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
915955660 1:160218080-160218102 TCATAAAGGCAAAAGCTGGAGGG - Intronic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
1062944133 10:1447504-1447526 TCAAAAATGCAGAAGCTGTATGG - Intronic
1064970926 10:21066068-21066090 CCATATGAGCATAAGCTGGATGG + Intronic
1065034808 10:21626834-21626856 TCACATATACAGATGCTGAAAGG - Intronic
1066284777 10:33954083-33954105 TCACATATGCAGAATATGAAAGG + Intergenic
1068464219 10:57367303-57367325 TCACAAATGCAGAATCTGAAAGG - Intergenic
1072447600 10:95513140-95513162 TCACCTTTGCCTAAGCAGGAGGG + Intronic
1073445435 10:103577557-103577579 TCACATCTAGAGAAGCTGGAAGG - Intronic
1077914445 11:6602127-6602149 TCACTTATACATAGGCTGGGGGG + Exonic
1080680280 11:34469391-34469413 TCACATATGCTGAAACTGTAAGG + Intronic
1086926234 11:92643506-92643528 TCACAGATGGACAAGATGGATGG - Intronic
1089781990 11:120879756-120879778 TCGCATGTGCAAAAACTGGAGGG - Intronic
1092000942 12:5031870-5031892 TCACATATTCACAAGCTGCAAGG - Intergenic
1093379995 12:18480463-18480485 TAACATATGAGTAGGCTGGAAGG + Intronic
1098501935 12:71202944-71202966 CCACAAATGCAAAAGCTGGGTGG + Intronic
1098688292 12:73453443-73453465 TTCCATATGCATTAGCTGAATGG - Intergenic
1098998929 12:77154149-77154171 TAACATATTCATAAGTTGCAGGG - Intergenic
1099919317 12:88938013-88938035 ACACACTTGCATAAGCTGGTTGG - Intergenic
1101767872 12:107719700-107719722 TCATATATGCATACCCTTGATGG - Intergenic
1102427697 12:112857325-112857347 TAACATATGCACAAGCTCCAGGG - Intronic
1104191534 12:126486209-126486231 TCACATATGCATGTTCTGCAGGG - Intergenic
1104659832 12:130603153-130603175 TTACATTTGCATATCCTGGATGG - Intronic
1105457274 13:20552977-20552999 TCACAAATGGATAAGCCAGAAGG - Intergenic
1107839677 13:44443390-44443412 TCAGACATACAAAAGCTGGAAGG + Intronic
1108149042 13:47512408-47512430 TCACATATACAGATTCTGGAGGG + Intergenic
1109575638 13:64253494-64253516 TTACAGATGCATCAGGTGGAAGG - Intergenic
1113128366 13:107006330-107006352 TCACAGATGCATAAGCCAGGGGG - Intergenic
1113436874 13:110299333-110299355 TCACAGCAGCATCAGCTGGAGGG - Intronic
1113476282 13:110583778-110583800 TCACATGTGAAAAAGCAGGAGGG - Intergenic
1118207945 14:63740730-63740752 ACACATATGTATAATTTGGAGGG + Intergenic
1122007474 14:98717373-98717395 TGACATATGCATAAGCCTCACGG - Exonic
1123126846 14:105952900-105952922 CCACATTTGCATAAGCTAAATGG - Intergenic
1126511770 15:49484365-49484387 ACACATATGCATCAGCTAAATGG + Exonic
1127361892 15:58251665-58251687 ACACAGAGGCACAAGCTGGATGG - Intronic
1128115952 15:65105637-65105659 TCATATATGCATACCCTTGATGG - Intronic
1132447365 15:101936754-101936776 CCACAGATGCATAAGCTCCAGGG + Intergenic
1133355210 16:5131125-5131147 ACCCATTTGCATGAGCTGGAGGG - Intergenic
1134592777 16:15469424-15469446 AGAAATATGAATAAGCTGGAAGG - Intronic
1138727994 16:59161888-59161910 TCACATTTGCATTGGCTGGAAGG - Intergenic
1139213861 16:65108341-65108363 TCACCAATGCATTAGTTGGAAGG + Intronic
1140857746 16:78992701-78992723 CTTCATATGCATTAGCTGGAAGG + Intronic
1146042488 17:29469834-29469856 TCAAATTTGAATAATCTGGAAGG - Intronic
1148798262 17:50207899-50207921 CCACATATGCAAAGGCAGGAGGG + Intergenic
1151005469 17:70431193-70431215 CCACATATTTATATGCTGGAAGG - Intergenic
1153014101 18:567725-567747 CCACCTATGGATAAACTGGATGG + Intergenic
1156874306 18:41988793-41988815 TCCTATATACATAAACTGGAAGG + Intronic
1158769762 18:60500711-60500733 TCACACATACATAAGCCTGATGG - Intergenic
1167024338 19:46904216-46904238 TCACAGATGCGGAAGCTGAAGGG - Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
937796704 2:126031278-126031300 TAAAATATGCATTATCTGGATGG + Intergenic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
945656700 2:212632759-212632781 TCACATAAGAATCACCTGGAGGG - Intergenic
948363884 2:237442089-237442111 TCACAAATCCATACTCTGGAAGG - Intergenic
1172405930 20:34689194-34689216 TCACATTTGCATCACCTGCATGG - Intergenic
1175842440 20:62037831-62037853 TCACGTATGCATACCCTTGATGG + Intronic
1179533565 21:42036663-42036685 TCAAATATCCATAATCTAGAAGG + Intergenic
1181997790 22:26896644-26896666 ACATATATGCATAAGCTAAATGG + Intergenic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
1185302395 22:50089245-50089267 TCACTTCTGCATCAGCTAGAGGG - Intergenic
949454125 3:4220405-4220427 TCACACATGAAAAACCTGGAGGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950133797 3:10566146-10566168 GGACAGATGGATAAGCTGGATGG - Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
956442196 3:69291464-69291486 TCACATATGCAAAAGTCGTAAGG + Intronic
957059054 3:75466771-75466793 ACCCATTTGCATGAGCTGGAGGG - Intergenic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963351033 3:144151344-144151366 TAACATTTGCTAAAGCTGGAGGG - Intergenic
963941613 3:151101613-151101635 TCTCATAAGAAAAAGCTGGAAGG + Intronic
965888659 3:173481410-173481432 TAACATATTCATAAGAAGGATGG - Intronic
965919630 3:173896321-173896343 TCACAGAAGGATCAGCTGGACGG - Intronic
969002967 4:3996958-3996980 ACCCATTTGCATGAGCTGGAGGG - Intergenic
969710743 4:8841516-8841538 TCACATATCTGTAAGATGGATGG + Intergenic
969810967 4:9647858-9647880 ACCCATTTGCATGAGCTGGAGGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
980970245 4:139560560-139560582 TGACAACTGCAGAAGCTGGAGGG + Intronic
982031423 4:151304917-151304939 GCCCATCTGCATAAGCTGGGAGG + Intronic
982251375 4:153410415-153410437 TAACACATGTTTAAGCTGGAAGG - Intronic
984268901 4:177526650-177526672 TCCCACTGGCATAAGCTGGAAGG + Intergenic
985885340 5:2673162-2673184 TCAGATATGCACAGGCTGCAGGG - Intergenic
988129785 5:27088824-27088846 GTACATTTTCATAAGCTGGAAGG + Intronic
991146867 5:63317357-63317379 CCACAAATATATAAGCTGGAAGG - Intergenic
991678989 5:69119201-69119223 TCACATAAGCAAAATCTTGATGG - Intronic
992613262 5:78525955-78525977 TCAGATAGGAAGAAGCTGGAAGG - Intronic
993827858 5:92714687-92714709 GCACATATGCATAAGCTCAGTGG - Intergenic
995840995 5:116443108-116443130 TTACATATTAATAAGGTGGAGGG - Intergenic
1000881570 5:166703817-166703839 TCATTTATGTATAAGATGGAAGG - Intergenic
1001334657 5:170787489-170787511 TCACATACACACCAGCTGGAAGG + Intronic
1001658298 5:173371091-173371113 TCACAAATGCAGAAGCAGGCTGG - Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003898553 6:10631749-10631771 ACACAAATGCCTGAGCTGGAAGG + Intergenic
1007246207 6:40464925-40464947 TCACATATTCATAGGCTCTAGGG - Intronic
1007847945 6:44776304-44776326 GCAGATATGCATGAGGTGGAAGG - Intergenic
1010167631 6:72935649-72935671 AGAAATAGGCATAAGCTGGATGG - Intronic
1010817355 6:80374444-80374466 TCATATATGCATACCCTTGATGG + Intergenic
1011140942 6:84155754-84155776 TCCCATGTGCATAGACTGGAAGG + Intronic
1014738202 6:125119801-125119823 TTACGCATGTATAAGCTGGAGGG - Intronic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015859325 6:137659084-137659106 TCACATATACAAAACCAGGAAGG + Intergenic
1021250505 7:18319716-18319738 TGACAAATACATAAGTTGGATGG - Intronic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1027818454 7:83010677-83010699 TCAGATAGGGATAAACTGGAGGG - Intronic
1029095411 7:98081415-98081437 ACGCATATTCATAAACTGGAAGG - Intergenic
1032661009 7:133983603-133983625 TTACATATACTTAAGCTAGAAGG + Intronic
1034909007 7:154976997-154977019 TCTCATCAACATAAGCTGGAGGG + Intronic
1034963889 7:155379617-155379639 TCACATATGCAGAGTCTGAAAGG + Intergenic
1037447360 8:18979544-18979566 TCACTCATGTATAAGCTGTAAGG - Intronic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1039819437 8:41123050-41123072 TAACATATGTAAAAGCTGTAAGG - Intergenic
1039896722 8:41721716-41721738 TCACACTTCCAGAAGCTGGAGGG - Intronic
1040994635 8:53389385-53389407 TAACAAATCCATAAGCTGGCTGG + Intergenic
1042764766 8:72308886-72308908 TCACACAGGCAGCAGCTGGATGG + Intergenic
1044893436 8:96862182-96862204 TCCCGTATGCATAAGCGGAAGGG - Intronic
1046870986 8:119205792-119205814 TCCCATAAGCACAGGCTGGAAGG + Intronic
1047014327 8:120707142-120707164 TGAAATATGCATAAGTTGCAGGG + Intronic
1055822392 9:80282532-80282554 TTACAGATGGATAATCTGGATGG - Intergenic
1185839642 X:3376673-3376695 TGACATCTGCCTAAGCTGGCTGG - Intergenic
1185975762 X:4718557-4718579 TCACACGTGCATAAGGTTGAAGG - Intergenic
1186858089 X:13644866-13644888 TTACATATGCATAAGATAGAGGG + Intergenic
1186873346 X:13793396-13793418 TAACATGTGCCTAAGGTGGACGG - Intronic
1187090302 X:16089210-16089232 GCACATAAGCATCAGCTGCAGGG + Intergenic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188613009 X:32122354-32122376 TCACATCAGAATCAGCTGGAGGG - Intronic
1189905106 X:45750754-45750776 TCAGGTATGCAAGAGCTGGACGG - Intergenic
1190503787 X:51105124-51105146 TCCAATAATCATAAGCTGGAAGG - Intergenic
1193956490 X:87870414-87870436 TCAAATATGCAGAAACAGGAGGG + Intergenic
1200050881 X:153431010-153431032 TCACATATGCATTAGACAGAAGG + Intergenic
1201236175 Y:11914192-11914214 TGACATCTGCCTAAGCTGGCTGG + Intergenic