ID: 1038714303

View in Genome Browser
Species Human (GRCh38)
Location 8:29978150-29978172
Sequence CCTTGGTAGGCTCTATGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038714303_1038714307 -2 Left 1038714303 8:29978150-29978172 CCTCAACATAGAGCCTACCAAGG No data
Right 1038714307 8:29978171-29978193 GGCTTCCCATAAATTAGAATTGG No data
1038714303_1038714312 26 Left 1038714303 8:29978150-29978172 CCTCAACATAGAGCCTACCAAGG No data
Right 1038714312 8:29978199-29978221 ATCATATCTAATTTTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038714303 Original CRISPR CCTTGGTAGGCTCTATGTTG AGG (reversed) Intergenic
No off target data available for this crispr