ID: 1038724438

View in Genome Browser
Species Human (GRCh38)
Location 8:30068003-30068025
Sequence CCACCAGATAACCACCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038724438_1038724440 -2 Left 1038724438 8:30068003-30068025 CCATTATGGTGGTTATCTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1038724440 8:30068024-30068046 GGCTAAAAATAATCTCCCTGTGG No data
1038724438_1038724443 19 Left 1038724438 8:30068003-30068025 CCATTATGGTGGTTATCTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1038724443 8:30068045-30068067 GGTTTTCATCTGCATTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038724438 Original CRISPR CCACCAGATAACCACCATAA TGG (reversed) Intronic
907608883 1:55847804-55847826 CTACCATATAATCACCAAAAGGG - Intergenic
907743499 1:57189862-57189884 ACAACAGAAAACAACCATAAGGG + Intronic
910800815 1:91143787-91143809 CCACCACATAGCCACTAAAATGG - Intergenic
912074746 1:105859468-105859490 CCACCAGATAAAATCCATTAAGG + Intergenic
914345688 1:146796718-146796740 CCACCTGCTAACCATCCTAATGG + Intergenic
918130185 1:181620656-181620678 CCACCAGATAAGTTCCTTAAGGG - Intronic
919020562 1:192099839-192099861 ACACCTGATAAACACAATAAGGG + Intergenic
919228705 1:194744168-194744190 CCACTATACAACCACCAAAAAGG - Intergenic
1063879165 10:10513015-10513037 TCACCAGAAAACCACCACCATGG - Intergenic
1064238713 10:13604576-13604598 CCAGCTGATAATTACCATAATGG - Intronic
1067758180 10:49022318-49022340 CCACCAGATAACCAGGAAATAGG - Intronic
1068502707 10:57860463-57860485 CCACCTGATAAAAACCAGAATGG + Intergenic
1069232633 10:66030752-66030774 CCAACAGATAACCTACAGAATGG + Intronic
1073589232 10:104740558-104740580 CTTCCAGATAACCTCCATAATGG + Intronic
1073668121 10:105556342-105556364 TCACCAGAAAACAACCCTAATGG - Intergenic
1075503519 10:123000746-123000768 CCACTAGACACCCACCAGAACGG - Intronic
1077651070 11:3973181-3973203 CTACCAGATCACCACCAGCATGG + Intronic
1078887206 11:15513778-15513800 CTACTAGATACCCACCAGAATGG - Intergenic
1082208773 11:49470995-49471017 CCACTATATAACCACCAGCATGG - Intergenic
1084739632 11:71131129-71131151 CCAACAAATAACCAACATCAAGG + Intronic
1086759302 11:90607352-90607374 CAAACAGATAACCCACATAATGG - Intergenic
1086981777 11:93206234-93206256 CCACCAGAAACCCACCATGCTGG - Intergenic
1088052772 11:105538412-105538434 ACACCAGATAACAATCATATTGG + Intergenic
1090422175 11:126583056-126583078 ACACCAGTTACCCACCATCATGG + Intronic
1091542854 12:1478239-1478261 CCACTAAATGACCACCAGAATGG - Intronic
1093002928 12:14018587-14018609 CCACTAGAGACCCACCAGAATGG - Intergenic
1097787162 12:63773400-63773422 CCACCCCATAACCTCCACAAAGG - Intergenic
1103241892 12:119420333-119420355 ACACCATAAAACCACCAAAATGG + Intronic
1106707505 13:32297462-32297484 CCAGCAGAGAACCACCGTGATGG + Exonic
1107142277 13:37013873-37013895 AGACCACATCACCACCATAACGG + Intronic
1107258166 13:38455732-38455754 CCAGCAGACATGCACCATAAAGG - Intergenic
1107974156 13:45673439-45673461 TCACGAGCTAACCACCTTAAAGG + Intergenic
1108767579 13:53651232-53651254 CCACCTGGTAACCACAAAAAAGG + Intergenic
1114188595 14:20423046-20423068 CCATAAAATAAGCACCATAATGG - Intergenic
1118395801 14:65335421-65335443 CCAACAGATAACAAACATTAAGG + Intergenic
1118985257 14:70748933-70748955 GGACCAGCTAACCACCATAGAGG - Exonic
1119515543 14:75245467-75245489 CCTCCAGATAGCCAAAATAAAGG - Intronic
1121196185 14:92074372-92074394 CCACCAGAGAACAACCAAAGTGG - Intronic
1122195070 14:100078699-100078721 TCACCACATAACCATCACAAGGG - Intronic
1125503603 15:40253876-40253898 CCCCCAAAAAACCACCAGAATGG - Intronic
1127406940 15:58659484-58659506 CCACCACATAAACATAATAAAGG - Intronic
1130222087 15:82028190-82028212 CCACCAGAAAACATCCATCATGG + Intergenic
1131297899 15:91168201-91168223 CTACCAGAAAACCAAGATAAAGG - Intronic
1132896086 16:2230029-2230051 CCACCAGGCACCCACCAGAATGG + Intronic
1134889585 16:17828055-17828077 CCACCATATATCCAACAGAATGG + Intergenic
1135130295 16:19848187-19848209 CCACCACACACCCACCAGAATGG - Intronic
1137232074 16:46575724-46575746 CCCCAAGATCACCACCATCATGG - Intergenic
1137340709 16:47601314-47601336 CCATTAGATAACCATTATAAAGG + Intronic
1137595688 16:49722062-49722084 CCACCACATTACCACCAGGAAGG + Intronic
1139988298 16:70918549-70918571 CCACCTGCTAACCATCCTAATGG - Intronic
1141840512 16:86571401-86571423 CCTCCCGATAACCTCCACAAGGG - Intergenic
1147696353 17:42357344-42357366 CCACAGGATAAACAGCATAATGG + Intronic
1150199528 17:63340311-63340333 CCACTAGAAAATCTCCATAAAGG + Exonic
1150863321 17:68823520-68823542 CCACCAAATCAGCACCATCATGG - Intergenic
1151805808 17:76404625-76404647 CCACCATATAACCCCCAGATTGG - Intronic
1153701471 18:7698781-7698803 ATACCACATAACCACCAGAATGG - Intronic
1158179136 18:54693430-54693452 CCATCAAGTAACCACCAAAACGG + Intergenic
1158549727 18:58425067-58425089 CCAACAGATAACAAAGATAAGGG - Intergenic
1165577568 19:36834514-36834536 CCACTACATATCCACCATATTGG + Intronic
925215377 2:2090287-2090309 ACACCAGACCACCACAATAAAGG + Intronic
925776497 2:7340672-7340694 CCCCCAGAAAACCACCAGATTGG - Intergenic
926901821 2:17759925-17759947 ACAGCAGATAATCACCAGAATGG + Exonic
930761146 2:55038574-55038596 CCACTACATAACCACTAAAATGG + Intronic
932106144 2:68944339-68944361 GCCCCATATAACCACCAGAATGG - Intergenic
933066620 2:77806244-77806266 CCACCAGGTGACCATCAAAAAGG - Intergenic
938187953 2:129249950-129249972 CCAGCAGATAGCCAACAAAAGGG - Intergenic
946765782 2:223038917-223038939 CCTCCAGGAAACTACCATAAAGG - Intergenic
1172051241 20:32120908-32120930 ACACCAGATAAACAGAATAAAGG - Intronic
1177887228 21:26761634-26761656 TCACCAGATCACCCCCATAGGGG - Intergenic
1178062713 21:28869950-28869972 CACCCAGATAAACAGCATAAAGG - Intergenic
1180082829 21:45494415-45494437 CCACCTGATAGCCTCCCTAAGGG - Intronic
1184448524 22:44568799-44568821 CCACTACATATCCACCAGAATGG + Intergenic
951240556 3:20281480-20281502 CCACAAAATATCCAACATAATGG - Intergenic
952727278 3:36599922-36599944 CCACCTGCTAGCCACTATAATGG + Intergenic
952868610 3:37876502-37876524 CCACTAAATACCCACTATAATGG - Intronic
953822959 3:46224244-46224266 GCAGCACATAACCACCAGAATGG + Intronic
955396331 3:58560321-58560343 TCACCAGAAAACAACCATGAGGG + Intergenic
956267449 3:67412966-67412988 CCACAAGATAACCACGGTCATGG + Intronic
957718370 3:83963375-83963397 CCACCAGAAAAAAATCATAAGGG - Intergenic
961586956 3:127938019-127938041 CCACCAGCAGACCACCATAAAGG + Intronic
961820859 3:129575013-129575035 CCTCCAGATTCCCACCATGAAGG - Intronic
965934103 3:174084553-174084575 AAACCAGATAACCAAAATAAGGG + Intronic
965955399 3:174362870-174362892 CCCCCAGACAACCTCAATAAAGG - Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966485959 3:180469719-180469741 CCACCAAAGAACAACTATAAAGG + Intergenic
967728146 3:192881246-192881268 CCAGCTGAGAACCACCATTATGG + Intronic
971019961 4:22524445-22524467 CCACCAGACAAACAGCCTAAAGG + Intergenic
972674606 4:41248001-41248023 CCACCACATACCCACAGTAAAGG + Intergenic
973116651 4:46468530-46468552 CAACCAGGTTACCCCCATAATGG - Intronic
973598554 4:52517812-52517834 CCACCACACAGCCACCAGAATGG + Intergenic
973908108 4:55550861-55550883 CCACAAGATAAACTCCAGAAGGG + Intergenic
976413698 4:84747057-84747079 CCACCAGACAACCAGAATGAAGG + Intronic
981864693 4:149402423-149402445 CCAACAGATATCCACCAAAATGG - Intergenic
982186522 4:152807452-152807474 CCACTACATAACCACTATAACGG - Intronic
983545470 4:168958735-168958757 CCACCAGATATCCATTAGAATGG - Intronic
984064121 4:175027010-175027032 CCTCCTGATAGCCATCATAATGG - Intergenic
984577169 4:181464339-181464361 CCACTACATACCCACCAGAATGG - Intergenic
990434220 5:55771722-55771744 CCACCACACAACCAGCAGAATGG - Intronic
990728073 5:58778391-58778413 CTCCCAGATAACCAACAAAATGG - Intronic
991443573 5:66676977-66676999 CCACCAGATGACCTTCAAAAAGG - Intronic
995051328 5:107708160-107708182 TCACCATAAAACCACCATAATGG + Intergenic
997122355 5:131188435-131188457 CCACCACATATCCATCAGAAAGG - Intronic
997495911 5:134325637-134325659 CCACTATATAACCACCAGAATGG - Intronic
998870170 5:146544001-146544023 CCACCAGATGCCAACCATACAGG - Intergenic
999130191 5:149276856-149276878 CCAAGAGATAAGCACCATAAGGG - Intronic
1002979705 6:2124499-2124521 CCAGCAGATAAACAGCACAATGG + Intronic
1003408465 6:5842145-5842167 CCTCAGGATAACCACCATCATGG + Intergenic
1004746826 6:18517869-18517891 CCACTACATAACCACTAGAATGG - Intergenic
1009409014 6:63343956-63343978 CCCCCAGAGAACCACCAGCAAGG + Intergenic
1013446837 6:110237742-110237764 TGACCAGAGAACCATCATAATGG + Intronic
1015983195 6:138859568-138859590 CCACCACATACCCACCCAAATGG - Intronic
1019902613 7:4034382-4034404 TCACCAGGTAACCACAATATTGG - Intronic
1022435421 7:30379436-30379458 CCACTACATACCCACTATAATGG - Intronic
1026166109 7:67911205-67911227 CCACCTAATAACCACCTTGAGGG - Intergenic
1031592930 7:123615588-123615610 ACACCAGAAAACCTCCATGAGGG + Intronic
1036690296 8:10940864-10940886 CCACCAGATATCGATCAGAAGGG + Intronic
1038724438 8:30068003-30068025 CCACCAGATAACCACCATAATGG - Intronic
1042572782 8:70184824-70184846 CCTCCAGATAGCCACCATTAAGG - Intronic
1044710532 8:95053371-95053393 CCATCAGATAACCACTAAACAGG - Intronic
1047944790 8:129864712-129864734 TCAGCAGATTACCACCATAAAGG - Intronic
1051128969 9:13837375-13837397 CCACTACATACCCACCAGAAAGG - Intergenic
1056586544 9:87931149-87931171 CCACCAGAACAACACCATCATGG - Intergenic
1057839293 9:98472510-98472532 CCTCCTGATAACCCCCAGAAGGG + Intronic
1058738211 9:107916230-107916252 CCACTACATATCCACTATAATGG + Intergenic
1060491189 9:124085732-124085754 CCACCAGGTACCCAGCACAATGG + Intergenic
1187081445 X:15993461-15993483 CCACCATATAATCAGAATAAGGG - Intergenic
1188063386 X:25628287-25628309 CCACCAGACAACCTACAAAATGG - Intergenic
1188630481 X:32351831-32351853 CCACCAGGTAAACACAAAAAAGG + Intronic
1188969344 X:36594471-36594493 CCACTACATATCCACCAGAATGG - Intergenic
1190840290 X:54137752-54137774 CCACTACATATCCACCAAAATGG + Intronic
1194579350 X:95652609-95652631 CCAGCAGATGACCACCAAGAAGG + Intergenic
1199948891 X:152689711-152689733 TCACCAGACACCCACCATACTGG + Intergenic
1199960785 X:152778738-152778760 TCACCAGACACCCACCATACTGG - Intergenic