ID: 1038729907

View in Genome Browser
Species Human (GRCh38)
Location 8:30117467-30117489
Sequence GTACAATGAAACCAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 9, 2: 5, 3: 12, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038729905_1038729907 1 Left 1038729905 8:30117443-30117465 CCATGATGCCAGCTGAGGTTGTC 0: 15
1: 8
2: 8
3: 12
4: 136
Right 1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG 0: 1
1: 9
2: 5
3: 12
4: 209
1038729906_1038729907 -7 Left 1038729906 8:30117451-30117473 CCAGCTGAGGTTGTCAGTACAAT 0: 10
1: 16
2: 7
3: 9
4: 78
Right 1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG 0: 1
1: 9
2: 5
3: 12
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038729907 Original CRISPR GTACAATGAAACCAAACTGA AGG Intronic
901342369 1:8506885-8506907 GTACAATGAAGCCCAACTATAGG + Intronic
903400396 1:23041374-23041396 GTAGAAAGAAACCAAGCAGAAGG - Intronic
905999552 1:42412490-42412512 GTACAGTGAAACCAAACTGATGG + Intronic
906314923 1:44780406-44780428 GTACAATGAAATCAAACTGGCGG + Intergenic
906851230 1:49252123-49252145 GTACATTGAAACCCAACAAAAGG + Intronic
907870627 1:58439346-58439368 GAACAATGAAACCAAGAAGAAGG - Intronic
908241225 1:62190826-62190848 GTACAATGAAACCAAACAGAGGG - Intergenic
911142463 1:94520593-94520615 GCAAAATGAAACCACAATGATGG - Intergenic
914944338 1:152050803-152050825 GAACAAGGAGATCAAACTGAGGG + Intergenic
915915736 1:159939637-159939659 GTAGAATGGAAGCAAACTGGAGG - Intronic
916564968 1:165967203-165967225 GATCAATGAGACAAAACTGAGGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918160704 1:181896352-181896374 GTAGAAAGAAACCAGACTGAAGG - Intergenic
918768599 1:188522559-188522581 GCATAAAGAAACAAAACTGAAGG + Intergenic
920684489 1:208099012-208099034 GGACAATGGAGCCAAACAGATGG - Intronic
921800571 1:219398478-219398500 GTACATTGAAACCCAACCCAAGG - Intergenic
921829992 1:219717226-219717248 TGACAATAAAACCAAAATGAAGG + Intronic
921871386 1:220144041-220144063 GTACAATGAAACCAAACTGGCGG + Intronic
922268191 1:224007924-224007946 TTAGAAAAAAACCAAACTGAGGG + Intergenic
922410390 1:225368293-225368315 GGCCAAAGAAAGCAAACTGAGGG + Intronic
923929236 1:238674645-238674667 GTTCTATGACACCAAACTGAAGG - Intergenic
1064924554 10:20555799-20555821 GTACTATGAGATCAAACTGCAGG + Intergenic
1065252807 10:23833915-23833937 AAACTATGAAACAAAACTGATGG - Intronic
1065768862 10:29057908-29057930 GTATTCTGAAACCAGACTGATGG + Intergenic
1069403697 10:68075822-68075844 GTACAAGGAAACTGAACTGGTGG - Intergenic
1071114783 10:82205312-82205334 TTACAATGAAAAGAAACAGATGG - Intronic
1073920493 10:108452628-108452650 GTACAACCACACCACACTGAAGG + Intergenic
1074932442 10:118142784-118142806 GTACAATACAACCAAAGTGTAGG - Intergenic
1075349830 10:121713894-121713916 GTACAATGAAACCAAACTGGCGG - Intergenic
1075515840 10:123107509-123107531 TTACACAGAAACCAAACAGAAGG - Intergenic
1078493767 11:11795598-11795620 GTACAATGATAGAAAATTGAGGG - Intergenic
1080088846 11:28319571-28319593 GTTCAAAGGTACCAAACTGAGGG - Intronic
1081286280 11:41274236-41274258 GTAGAAGGAAACCCAACAGATGG + Intronic
1083230054 11:61311524-61311546 CTACAAAGGACCCAAACTGATGG + Intronic
1083387921 11:62325770-62325792 ATACAATCAACTCAAACTGAGGG + Intergenic
1085834755 11:79940841-79940863 TTAAAATGAAACTGAACTGAAGG - Intergenic
1087190285 11:95247194-95247216 TTACAATGGAAAAAAACTGAAGG - Intergenic
1087230006 11:95650484-95650506 ATACCATAAAAGCAAACTGAAGG + Intergenic
1087463918 11:98480359-98480381 GTACATTGAAACATAACTGTTGG + Intergenic
1091162748 11:133439778-133439800 TTATAATAAAACCAAACTAAAGG + Intronic
1091482565 12:848917-848939 CAACAAATAAACCAAACTGAGGG - Intronic
1095496282 12:42788119-42788141 GTAAAATCAAAACAAACAGAAGG + Intergenic
1096925648 12:55142177-55142199 GTAAAATGATGCCAAACAGAAGG + Intergenic
1097395498 12:59068430-59068452 GGAAAATGAAACAAAATTGATGG - Intergenic
1097600324 12:61684083-61684105 GTAGAATGAAATGAAACAGAAGG + Intergenic
1098454836 12:70660246-70660268 TTTTAATGTAACCAAACTGAAGG - Intronic
1099449307 12:82789799-82789821 GAACACAGAAAGCAAACTGAGGG - Intronic
1099513061 12:83562083-83562105 GGACAATCAAACCAAAATGTAGG - Intergenic
1099723340 12:86392561-86392583 GTGCAATAAAACCAAAAAGAAGG + Intronic
1100399913 12:94220520-94220542 ATGCAATGAACTCAAACTGATGG - Intronic
1101129167 12:101671402-101671424 CTCCCATGAAACCAAACTAAAGG + Intronic
1101196104 12:102384587-102384609 GGACAATGTAAGCAAACAGATGG - Intergenic
1104191168 12:126482799-126482821 GTAAAAAGAAGCCAATCTGATGG + Intergenic
1104781876 12:131427053-131427075 GAAAAAGGAAACAAAACTGAAGG - Intergenic
1106048689 13:26169447-26169469 GTACAGTTAAGCCAAGCTGAGGG - Intronic
1108444327 13:50492103-50492125 GTACTTTGAAACCCAACAGAGGG + Intronic
1112309058 13:98301720-98301742 GTACATTGAAAACACACAGAGGG + Intronic
1112939024 13:104838176-104838198 GAACAATGAAACGAGACAGAGGG + Intergenic
1113594967 13:111524714-111524736 GCAAAATGAAAACAAAGTGATGG - Intergenic
1116045489 14:39737866-39737888 GAAAAATGAAACCATACAGATGG - Intergenic
1116868913 14:50053458-50053480 GGTCAATAAAACCAAACTGATGG - Intergenic
1117388879 14:55244047-55244069 GTACATTGAAATCACCCTGAAGG - Intergenic
1118238708 14:64036645-64036667 GTAAAATGGAAAGAAACTGAGGG - Intronic
1118836824 14:69484110-69484132 GCACAGTGAAACCCACCTGAGGG + Intergenic
1118977779 14:70692359-70692381 GAACAAGGAAACGAAACTGCTGG + Intergenic
1122257661 14:100490793-100490815 CTACAATGCCACAAAACTGATGG - Intronic
1126267279 15:46769240-46769262 TTCCAATGAAACCAAAATCATGG - Intergenic
1127960906 15:63890038-63890060 GTAGAATGATGCCAAACTGCCGG - Intergenic
1128473169 15:67973899-67973921 GTACAATGAATTGAAACTGGTGG + Intergenic
1130610720 15:85358458-85358480 GTATAATGCATCCAAAATGAAGG + Intergenic
1130813199 15:87404166-87404188 GTCAAATGAGACGAAACTGAAGG + Intergenic
1131505242 15:93012076-93012098 TTATAATGAAACAAAGCTGAAGG - Intronic
1131993321 15:98110735-98110757 GTAGAATGAATCCTAACTGGTGG + Intergenic
1133052078 16:3122880-3122902 GGACCATGAAGACAAACTGAAGG - Intergenic
1134313994 16:13101492-13101514 GTGCCAGGTAACCAAACTGAAGG + Intronic
1135054780 16:19222115-19222137 GTACAATGACACCATATCGAGGG + Intronic
1136218800 16:28814063-28814085 GTACAATGAAACCAAACTGGCGG + Intergenic
1137042781 16:35628621-35628643 GTAAACTGAAACCTAACTGGAGG - Intergenic
1139068552 16:63350840-63350862 GTACAATGAAACCAAACTAGCGG + Intergenic
1140151739 16:72374380-72374402 TTACAATAAGACTAAACTGAAGG + Intergenic
1140525788 16:75621889-75621911 GCACTGTAAAACCAAACTGAAGG + Intronic
1140737599 16:77911910-77911932 GTTCACTTAAAACAAACTGACGG + Intronic
1142821896 17:2475743-2475765 GTAGAATTAGAGCAAACTGATGG + Intronic
1143907217 17:10218588-10218610 GTACAAGGAAACCCAGCAGATGG + Intergenic
1144491855 17:15719673-15719695 ATATAATGAAACTTAACTGACGG - Exonic
1145205094 17:20980305-20980327 CTTTAATGAAAGCAAACTGAGGG - Intergenic
1145804380 17:27715995-27716017 GTACAAGGCATCTAAACTGAAGG + Intergenic
1146790637 17:35748670-35748692 GTGCACTGAAACCAAACTTGGGG + Intronic
1149474886 17:56952299-56952321 GTACAGTGAAACCAAACTGGTGG - Intronic
1150480582 17:65505956-65505978 GTGCTGTGAAAACAAACTGACGG + Intergenic
1153603688 18:6809373-6809395 CTAGAATGAAACCATAATGAGGG + Intronic
1156157287 18:34318171-34318193 GAACACTGAAAACAAAATGAAGG - Intergenic
1157382685 18:47234334-47234356 GTAAAATGTAGCCAACCTGAAGG - Intronic
1157862732 18:51155377-51155399 CTATAATGAAAACAAAATGAAGG - Intergenic
1159019115 18:63128527-63128549 GTACCATGAAACAAAGCTGCAGG - Exonic
1159875646 18:73808057-73808079 CTACTATGTAACCTAACTGAAGG - Intergenic
1160087429 18:75789739-75789761 GTACACTGAAACCAAAGGGGTGG + Intergenic
1162662143 19:12178462-12178484 ATACAATCAAACCTAACTCAGGG - Intronic
925806603 2:7657049-7657071 GTAGATTGAAAATAAACTGAAGG + Intergenic
926709457 2:15866185-15866207 GCAGAATTAAACCAAACTCATGG - Intergenic
927342262 2:21995928-21995950 GTACAAACAATCCAAACTTAGGG + Intergenic
928921849 2:36534834-36534856 GTACAAAGAAACCAGACAGGAGG - Intronic
930256338 2:49097205-49097227 GTACAACACAATCAAACTGATGG - Intronic
930898807 2:56479105-56479127 GTAAATTGAAAGCAAAATGATGG - Intergenic
931009278 2:57889591-57889613 GTATAATGAAACCAATCTAGTGG + Intergenic
931401888 2:61938792-61938814 TTACAAGGAAACCAAAATTATGG - Intronic
931772667 2:65511851-65511873 GTACAATAAAACCAAACTGGTGG + Intergenic
932510894 2:72289010-72289032 ATACAATGAAACTAAACTGGCGG - Intronic
932662921 2:73672659-73672681 CTGCAGTGAAACCAAACTCAAGG + Intergenic
937978996 2:127601860-127601882 TTATAATGAAACCACATTGAAGG - Intronic
938085108 2:128394664-128394686 GTACAATGAAACCTCTCTGATGG - Intergenic
939172541 2:138712313-138712335 GTGGAATCAAACCAAACTGCTGG + Intronic
940492345 2:154379012-154379034 GTAAAATGAAACCATAATAACGG + Intronic
943167683 2:184351043-184351065 CTACAGTGAAATGAAACTGATGG + Intergenic
943629625 2:190236253-190236275 GTTAAATGAAACTAAGCTGAAGG + Intronic
944053792 2:195501674-195501696 GTTTAATAAAAGCAAACTGATGG + Intergenic
945603334 2:211894696-211894718 ATTCAATGACACCAAACTGTTGG + Intronic
946037004 2:216752063-216752085 ATACAATGAAACCCAATTGGAGG - Intergenic
948624248 2:239258823-239258845 GTTCAATGTAAACAAACTAAAGG + Intronic
1170976121 20:21166289-21166311 GTACAATGAAACCAACTGGCAGG + Intronic
1171914627 20:31053786-31053808 ATAGAATGGAATCAAACTGAGGG + Intergenic
1172522211 20:35575221-35575243 GAACAATATAACCACACTGAAGG - Intergenic
1177489054 21:21797683-21797705 GAAAAATGCAACCAAACTGAAGG + Intergenic
1177577150 21:22972669-22972691 GACCAATGAAACAAAATTGAGGG - Intergenic
1178022289 21:28422873-28422895 GGACACAGAAACCACACTGAAGG + Intergenic
1179078906 21:38151944-38151966 GCACAGAGAAACCAAAGTGATGG - Intronic
1179521048 21:41944943-41944965 GAACAATATAACCACACTGAAGG + Intronic
1180615979 22:17127646-17127668 GTACAATGAAAACACAAAGAAGG + Intronic
1183206271 22:36421353-36421375 GTACAATGAAACCAAACTGGCGG + Intergenic
950179264 3:10899730-10899752 GGAAAATGACACCATACTGATGG - Intronic
953198080 3:40752772-40752794 GAAAAATGAAGCCAAGCTGAGGG - Intergenic
953687522 3:45089725-45089747 GAACAATTGAAACAAACTGAGGG + Intronic
957296275 3:78336793-78336815 CTATAATGAAAACAAGCTGAAGG - Intergenic
958464780 3:94443782-94443804 GTACATTGAAACCCAATGGAAGG + Intergenic
958746256 3:98139026-98139048 GTACAATAAGAACAAACTCAAGG + Intergenic
958749767 3:98181719-98181741 GTACAATAACAACAAACTCAAGG + Intronic
959359687 3:105372681-105372703 ACACAATGAAACTAAACTGCTGG + Intronic
960234861 3:115270538-115270560 CTTGAATGAAATCAAACTGATGG - Intergenic
962427595 3:135285801-135285823 GAGCAATGGAACAAAACTGAAGG - Intergenic
962556477 3:136557355-136557377 GTACAATCAAGAAAAACTGAAGG + Intronic
962630084 3:137266691-137266713 TTACAATGAAAGCAAACTGATGG + Intergenic
964001452 3:151778469-151778491 GTTCAATGAATTCAAAATGAGGG + Intergenic
964436964 3:156663648-156663670 GGACAAAGAAAGCAAATTGAAGG - Intergenic
964908862 3:161753138-161753160 GTACAATAAGAGCAAAGTGAAGG - Intergenic
965402776 3:168232976-168232998 GTACAATGAAAAACAAGTGAAGG - Intergenic
966419268 3:179721419-179721441 GGACAATGACATCAAGCTGAGGG + Exonic
967504224 3:190235407-190235429 GTACACAGGAACCAAACTGAAGG - Intergenic
967550452 3:190788695-190788717 GTAGACTGAAAGCAACCTGATGG + Intergenic
968681586 4:1924583-1924605 GTAATATAAAACCAAACTGAAGG + Intronic
968734388 4:2287847-2287869 GTACTTTGGAACCAAACTGCGGG - Intronic
969420878 4:7095093-7095115 GTAAAAGGAAGCCAAACTCAAGG - Intergenic
971754621 4:30691360-30691382 GATCAATGAAACAGAACTGAGGG - Intergenic
972787707 4:42342891-42342913 GTAAAAGGAAACCAAAATGAAGG + Intergenic
972871713 4:43308835-43308857 GTAAAATAAAATCAAATTGAAGG + Intergenic
976869339 4:89771864-89771886 GGATAATGAAACCAAGCTAAAGG + Intronic
976893049 4:90074252-90074274 GTACAATGAAAGAATACTAAAGG - Intergenic
977004932 4:91554842-91554864 GAACAATGAAACAAAATAGAGGG + Intronic
978689068 4:111484582-111484604 GTACACTGAAACCCAAGTCAAGG + Intergenic
981869100 4:149465027-149465049 ATACAATGAAAATAAAATGAAGG - Intergenic
982599791 4:157433182-157433204 GAACACTGAAAGAAAACTGAAGG - Intergenic
984233395 4:177127867-177127889 GAACATTGAAACCAAAGGGAAGG + Intergenic
984689700 4:182712563-182712585 GTACAATGAAATTACACTTATGG - Intronic
985222742 4:187725522-187725544 GTAAAATAAAACCAAAATGTAGG + Intergenic
987555566 5:19442574-19442596 TTACAATAAAACCAAGTTGAAGG + Intergenic
988584739 5:32498569-32498591 AAACACTGAAACCAAACTGCTGG - Intergenic
990113871 5:52364764-52364786 GCATAATGAATCCAAATTGAAGG - Intergenic
990519498 5:56565144-56565166 GTACAATGAAAACATACTGTGGG + Intronic
992497837 5:77310587-77310609 GCACAATGAAAACCAACTGGAGG - Intronic
994548064 5:101194264-101194286 ATACAATGAAAGTAAACTTATGG + Intergenic
994824458 5:104695483-104695505 ATAAAATGTAATCAAACTGAGGG + Intergenic
995071791 5:107931081-107931103 GAACAATAAAACCCAAGTGATGG + Intronic
995824356 5:116277127-116277149 GTACAATGATACCTAAATAAAGG - Intronic
995956727 5:117785423-117785445 GTGCAAAGAGACTAAACTGATGG - Intergenic
996296740 5:121927555-121927577 GTAAAATCAAGCAAAACTGATGG + Intergenic
998461090 5:142310698-142310720 GTAACATGAAACCAAGCTGTGGG + Exonic
998643399 5:144037246-144037268 GCACAATGAATGCAAACTCAAGG - Intergenic
999654795 5:153801172-153801194 GAACAATCAAACACAACTGATGG - Intronic
999654825 5:153801334-153801356 GAACAATCAAACACAACTGATGG - Intronic
1000195040 5:158948871-158948893 GTATAATTAAAATAAACTGAGGG - Intronic
1003673059 6:8177785-8177807 GTACAATTAAAACCAACAGAGGG + Intergenic
1006651583 6:35556159-35556181 GTACAATGAAACCAAACTGGTGG - Intergenic
1008441528 6:51537236-51537258 GTACAATGAAACCAAACTGGTGG + Intergenic
1009667138 6:66697591-66697613 GACCAATGATACCAAACAGAGGG + Intergenic
1009721961 6:67483191-67483213 GTAAAATGAAAGAAAAATGAGGG + Intergenic
1010748086 6:79587068-79587090 GTACAATGACAACACACTGGGGG - Intergenic
1010985195 6:82415359-82415381 GTATAATGAAACAAAAAAGAGGG + Intergenic
1011779078 6:90766464-90766486 TTGCAGAGAAACCAAACTGAGGG + Intergenic
1013738057 6:113249856-113249878 GTACATTGAAACCCAATTCAAGG + Intergenic
1015678996 6:135782417-135782439 GTACATTGAAACCAAATCCAAGG + Intergenic
1021242043 7:18214854-18214876 GTCCACTCAAAGCAAACTGATGG + Intronic
1026354491 7:69545734-69545756 GTACAATGAAAAGAAAATGCAGG + Intergenic
1028326295 7:89530014-89530036 GTAAAATAAAACAAAAATGATGG - Intergenic
1029807420 7:103011296-103011318 GTACAATAAAACAATACTGGAGG + Intronic
1030214195 7:107027353-107027375 TTACAATGAAATCAGACAGAAGG - Intergenic
1031259524 7:119500683-119500705 GTAAAATTACACCAAATTGAAGG + Intergenic
1032602578 7:133315082-133315104 GTACAATGAAACCAAACTGGTGG + Intronic
1035581885 8:745640-745662 ATACTATGAAACAAAACTGGAGG - Intergenic
1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG + Intronic
1038972854 8:32656790-32656812 GTACAATGGAAATAAGCTGATGG + Intronic
1041933577 8:63312698-63312720 TTATAATGAAACAACACTGAAGG - Intergenic
1044311099 8:90693699-90693721 CTATAATGAAACCCAACTGTAGG + Intronic
1044651605 8:94501349-94501371 GAACCATATAACCAAACTGAAGG + Intronic
1044735590 8:95275081-95275103 GCAAAGTGAAACCAAATTGATGG + Intergenic
1044871492 8:96624633-96624655 GGACATAGAAACCAGACTGAAGG - Intergenic
1046557585 8:115794078-115794100 GTAAAATTAAAACAAACTCACGG + Intronic
1047312628 8:123705399-123705421 GTAGCATGACACCAAACTGCGGG - Intronic
1048664775 8:136648721-136648743 GTACTATGAAAACAAAGAGAAGG - Intergenic
1048887991 8:138924068-138924090 GAATAATGCAACAAAACTGAAGG - Intergenic
1049172093 8:141167806-141167828 GTACCATGGAAGCAAAGTGAGGG + Intronic
1049834484 8:144725767-144725789 GTACGAGAAAACAAAACTGAAGG + Intronic
1053433054 9:38056240-38056262 ATACAATGAAATCAAACTCTAGG + Intronic
1057432865 9:95010848-95010870 TTACAAAGAAACCAAACAAAAGG + Intronic
1058135685 9:101305327-101305349 GCCAAATGACACCAAACTGAAGG - Intronic
1058743070 9:107963783-107963805 GTACTATGAAACCAAACAGGTGG + Intergenic
1058930102 9:109710340-109710362 GCACAAAGAAACCAGACTGCTGG - Intronic
1059690319 9:116678582-116678604 GTGTAATGGAACAAAACTGAAGG + Intronic
1059952833 9:119484939-119484961 GTCTGATGAACCCAAACTGAGGG + Intergenic
1060466629 9:123912697-123912719 CTCCACTGAAACCACACTGATGG - Intronic
1060561131 9:124544631-124544653 GTACAAAAAAAGCAAGCTGAAGG + Intronic
1186526490 X:10253932-10253954 GGGAAATGCAACCAAACTGAGGG - Intergenic
1187279420 X:17846592-17846614 ATGCAATGAAAACAAATTGATGG - Intronic
1188169539 X:26906946-26906968 GAATACTCAAACCAAACTGAGGG + Intergenic
1189519231 X:41748503-41748525 GTACAGTGAATCCAAACTGGTGG - Intronic
1190361464 X:49653278-49653300 GTACAATAAAAACAAATTGCTGG - Intergenic
1191686274 X:63894831-63894853 ATACAACATAACCAAACTGATGG + Intergenic
1191763114 X:64665152-64665174 GAACATTGAAACCCAATTGAAGG + Intergenic
1194556506 X:95367345-95367367 GTATCATGAAACCCAACTGGGGG - Intergenic
1196943621 X:120802080-120802102 GAACAATGAAGCAAAGCTGAGGG - Intergenic
1197971687 X:132121002-132121024 GTACAAAGAAAGCCAAGTGAAGG - Intronic
1198591296 X:138185700-138185722 GTACAAGGAAACTAGACAGAGGG - Intergenic
1198762935 X:140052776-140052798 ATACCATGAAACCTAACTCATGG - Intergenic
1200336389 X:155354995-155355017 GAAGAATGTAACCAACCTGACGG + Intergenic
1200350081 X:155486232-155486254 GAAGAATGTAACCAACCTGACGG - Intergenic
1200389287 X:155927584-155927606 GTACACTGAAACAGAACTGCAGG - Intronic
1200674526 Y:6134851-6134873 GCACAAGGAAACCACACTAATGG - Intergenic
1201011483 Y:9551214-9551236 GTATGATGATACCAAAATGAAGG - Intergenic