ID: 1038731426

View in Genome Browser
Species Human (GRCh38)
Location 8:30131396-30131418
Sequence CTTTGCAATGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39153
Summary {0: 1, 1: 5, 2: 131, 3: 3234, 4: 35782}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038731426_1038731431 11 Left 1038731426 8:30131396-30131418 CCTTCCACCTCAGCATTGCAAAG 0: 1
1: 5
2: 131
3: 3234
4: 35782
Right 1038731431 8:30131430-30131452 CAGTTATGAGCCACTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038731426 Original CRISPR CTTTGCAATGCTGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr