ID: 1038732363

View in Genome Browser
Species Human (GRCh38)
Location 8:30138899-30138921
Sequence CTTTTCTTCTGAAGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 477}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038732363_1038732366 -8 Left 1038732363 8:30138899-30138921 CCTTTTGTTCTTCAGAAGAAAAG 0: 1
1: 0
2: 2
3: 64
4: 477
Right 1038732366 8:30138914-30138936 AAGAAAAGAATCACGGGAGAAGG 0: 1
1: 2
2: 19
3: 162
4: 767
1038732363_1038732368 0 Left 1038732363 8:30138899-30138921 CCTTTTGTTCTTCAGAAGAAAAG 0: 1
1: 0
2: 2
3: 64
4: 477
Right 1038732368 8:30138922-30138944 AATCACGGGAGAAGGAGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1038732363_1038732370 24 Left 1038732363 8:30138899-30138921 CCTTTTGTTCTTCAGAAGAAAAG 0: 1
1: 0
2: 2
3: 64
4: 477
Right 1038732370 8:30138946-30138968 AAATTTGTAAATTTCCACCTTGG 0: 1
1: 0
2: 2
3: 26
4: 353
1038732363_1038732367 -1 Left 1038732363 8:30138899-30138921 CCTTTTGTTCTTCAGAAGAAAAG 0: 1
1: 0
2: 2
3: 64
4: 477
Right 1038732367 8:30138921-30138943 GAATCACGGGAGAAGGAGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038732363 Original CRISPR CTTTTCTTCTGAAGAACAAA AGG (reversed) Intronic
901731519 1:11283630-11283652 ACTTTGTTCTGAAGAACTAAGGG + Intronic
903230372 1:21918752-21918774 CTTTATTTCTGAATAATAAAGGG + Intronic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
904000445 1:27335709-27335731 CCTTTCAACAGAAGAACAAAGGG - Exonic
905592201 1:39173874-39173896 CTTTTCTTCTGGCAAACAAAAGG - Intronic
906042823 1:42802040-42802062 CTTTTCTTATGAAACACCAAAGG + Intergenic
906812785 1:48846205-48846227 CCTTTCTTTTAAAGTACAAATGG - Intronic
908568946 1:65388587-65388609 TTTATCTTCAGAAGTACAAAGGG + Intronic
909411293 1:75354837-75354859 CCTTTCTTCTTGAGAACATAGGG - Intronic
909822663 1:80085907-80085929 ATTGTGCTCTGAAGAACAAAGGG - Intergenic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
913426292 1:118734593-118734615 CCTTTCTTTTGAAAAACAAATGG + Intergenic
913608900 1:120491860-120491882 CTTCTCATCTGAAGCACAAGTGG + Intergenic
914194872 1:145441948-145441970 CTCTTCTTCTGAGGAAAACAGGG - Intergenic
914476146 1:148024515-148024537 CTCTTCTTCTGAGGAAAACAGGG - Intergenic
915995034 1:160553378-160553400 CTTGTCTTCTCTTGAACAAACGG + Exonic
916755381 1:167764526-167764548 CTTTTCTTATAAAGAACTTAAGG - Intronic
916908702 1:169319692-169319714 TTTTTCTTCTGAAAAACAGGGGG + Intronic
916964053 1:169916872-169916894 CTTTTCTTATGAAAATTAAATGG + Intergenic
917017968 1:170556066-170556088 ATAAGCTTCTGAAGAACAAAAGG - Intergenic
917334245 1:173912165-173912187 CTTGTGTTCTGATGAATAAAAGG + Intronic
917756510 1:178105237-178105259 CTTTTCTTCAGAAAAAATAATGG + Intronic
918465680 1:184819106-184819128 CTCTTCATATGAAGAAGAAAAGG + Intronic
918730597 1:187989553-187989575 CTTTTCCTCTGAAGAACTGATGG - Intergenic
921379855 1:214513433-214513455 TTTTTTTTTTGAAGAACTAATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922024223 1:221736006-221736028 CTCATCTTCTAAAGAATAAATGG - Intronic
923360051 1:233202200-233202222 TTTTACTTCTGAAAAAAAAAAGG - Intronic
923499148 1:234550309-234550331 CCTTTCTTCCCAAGAACACATGG - Intergenic
923908838 1:238416768-238416790 CATCTCTTCTGAACAACAAAAGG + Intergenic
924217707 1:241841148-241841170 CTCGTCTTCTGAAGACCAAATGG + Intergenic
924838454 1:247679954-247679976 CTTTTTCTGTGAAGACCAAAAGG + Intergenic
1062780601 10:202281-202303 CTTTACTTTTGAAGAAAAATAGG + Intronic
1062827468 10:583216-583238 GTTTTCTTCTGAAAAGCCAAGGG + Intronic
1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG + Intronic
1063153314 10:3355957-3355979 CTATAATGCTGAAGAACAAATGG + Intergenic
1063156063 10:3380051-3380073 CTGTTCTTCTGCAGAAAACAGGG + Intergenic
1063513779 10:6673405-6673427 CTTCTCTTCTTTAGAACAGAAGG - Intergenic
1063514751 10:6684769-6684791 CCTTTCTGCTGCAGAACAGATGG + Intergenic
1064488410 10:15822095-15822117 CTTTGATTTTGAAAAACAAATGG + Intronic
1065632599 10:27695820-27695842 TTTTTATACTGAAGAAGAAAAGG + Intronic
1066433421 10:35374158-35374180 CCTTTCCTTTGTAGAACAAATGG + Intronic
1067700787 10:48570385-48570407 TTTTTCTTCTGCAGCACTAATGG + Intronic
1068174507 10:53440722-53440744 TAATTCTACTGAAGAACAAAGGG - Intergenic
1068569484 10:58613604-58613626 CGTTAGATCTGAAGAACAAAGGG - Intronic
1068739380 10:60451485-60451507 CTTGCCTTTTGAAGAACACATGG + Intronic
1069491105 10:68861294-68861316 GTATTCTTCAGAAGAACAAAGGG + Intronic
1069491930 10:68868327-68868349 CTATTCTTCACAAGAACAAAGGG + Intronic
1069786853 10:70993952-70993974 CATGTCTTCTGAAGACCAGAGGG - Intergenic
1070277862 10:75024961-75024983 CTTTTCTTCTTTAGTACAAAAGG - Exonic
1070277863 10:75024962-75024984 CTTTTGTACTAAAGAAGAAAAGG + Exonic
1071547280 10:86538324-86538346 GGTTTCTTGTGAAGAGCAAAAGG + Intergenic
1071918189 10:90320033-90320055 TTTTACTTATGAAGAATAAAAGG + Intergenic
1072340420 10:94442859-94442881 TTTTTCTTCTGAGCAATAAAAGG - Intronic
1073897174 10:108175988-108176010 TTTTACTTCTTAAGAGCAAAAGG - Intergenic
1074179086 10:111042117-111042139 ATATTCTTCTGAAGCACATAGGG + Intergenic
1074393784 10:113079962-113079984 CTTTTCTTCTCACCAATAAAAGG - Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077448590 11:2618633-2618655 ATTCTGTTCTGAAAAACAAAGGG - Intronic
1077820992 11:5740461-5740483 CTTATCTCCTGAAGTAAAAAGGG + Intronic
1077970965 11:7189547-7189569 CTTTTCTTTAGTAGAACAAAAGG + Intergenic
1078179117 11:8995739-8995761 GATTTTTTCTGAAGAACAATGGG - Intronic
1078630137 11:12995103-12995125 CTTTTCTTCTGTAAAAGGAAGGG + Intergenic
1078736044 11:14021894-14021916 CTTTATTTGTAAAGAACAAAGGG + Intronic
1079421012 11:20288069-20288091 CTTTCCTTTTGCACAACAAAGGG - Intergenic
1080323307 11:31040593-31040615 ATTTTCTACTGAAAAACAAAAGG + Intronic
1081326879 11:41755795-41755817 CCTTTCTTATGAATAACCAAAGG + Intergenic
1081344807 11:41971573-41971595 CTTTCCATCTGAAGAACCAAAGG + Intergenic
1081385952 11:42473462-42473484 CTTTTCTTCTGAAGCCTATAGGG + Intergenic
1082142482 11:48625638-48625660 CACATCTGCTGAAGAACAAAAGG - Intergenic
1082569644 11:54722443-54722465 CATATCTGCTGAAGAACAAAAGG - Intergenic
1084930225 11:72549420-72549442 CTTTTCTTGCTAAGAATAAATGG - Intergenic
1085192183 11:74636765-74636787 ATACCCTTCTGAAGAACAAATGG - Intronic
1085619964 11:78030630-78030652 ATTGTCTCCTGAAGAACAGAGGG - Intronic
1085708592 11:78809283-78809305 CTTTGCTTCTGAAGGTCAACTGG + Intronic
1085836101 11:79958294-79958316 TGTTTCTTTTGAAGAACACAAGG + Intergenic
1085869932 11:80337547-80337569 TTTTTCTTTTGAAGTACACATGG - Intergenic
1087194011 11:95286352-95286374 TTTTTCTTCTGAATATCATATGG + Intergenic
1087203979 11:95374746-95374768 GTTTACATCTGAAGAACAATGGG + Intergenic
1087649974 11:100854190-100854212 CTTATCTTCTGAAAAAGAAGAGG + Intronic
1087750540 11:102002438-102002460 CTTTCCATCTGAAGAACCAGGGG + Intergenic
1088090233 11:106029933-106029955 GTTTTTTTCTGAAGAGGAAAAGG + Intergenic
1088709351 11:112493190-112493212 TTTTTTTTTTGAAGAAAAAAAGG - Intergenic
1088885140 11:114000277-114000299 CTCTTCTTCTGTACAACAAAAGG - Intergenic
1089313314 11:117574174-117574196 CAATTCTCCAGAAGAACAAATGG + Intronic
1089425218 11:118367952-118367974 CTTTTCAACTGATGAACAATAGG - Intronic
1089431796 11:118431009-118431031 CTTTTTTTCTGGGGAAAAAAGGG - Intronic
1089572790 11:119421478-119421500 ATTTTCTTCTGAACAGGAAATGG - Intronic
1090233101 11:125124257-125124279 CTTTTCTTTGGAAGGAGAAAGGG + Intergenic
1091331118 11:134731586-134731608 CTTTTCTTGCAAAGAATAAAAGG + Intergenic
1091612947 12:2026834-2026856 CTTTTCTTATGAAGTACTATTGG + Intronic
1092415257 12:8286048-8286070 CTTTTCTTCTTTAGAATAAGTGG + Intergenic
1092603666 12:10095528-10095550 CTTTTTTTTTGAAGATAAAATGG - Intronic
1092747499 12:11687487-11687509 ATTTTCTTATTAAGAAAAAAAGG - Intronic
1092947196 12:13467541-13467563 CTTTTCTTCTTAACAGCATAAGG - Intergenic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093499907 12:19799702-19799724 TTTTTTATCTGAAGAAGAAATGG - Intergenic
1094018343 12:25887079-25887101 TTTTTCTTCTAAAAAATAAAGGG - Intergenic
1095358101 12:41301340-41301362 CTGTTCTGCAGAATAACAAAGGG - Intronic
1096710864 12:53454408-53454430 TTTTTCTGCTGAAGGACAAGTGG + Intronic
1096806293 12:54143163-54143185 CTTTTCCTCTGAAGACCTCAGGG + Intergenic
1098132525 12:67365472-67365494 CTTTTCTTCTGGAGACCCATTGG - Intergenic
1098493364 12:71107649-71107671 CTGTTCTTGTGAAAAAAAAAAGG - Intronic
1098804428 12:75004527-75004549 CTTTTCATCTAGAGACCAAAGGG - Intergenic
1098860922 12:75708952-75708974 CTTGACTCCTGAAAAACAAAGGG + Intergenic
1098992760 12:77082929-77082951 GTATTCTTCTCAAGAACATAAGG + Intergenic
1099721401 12:86365693-86365715 TTTTTTCTCTGAAGATCAAATGG + Intronic
1100113404 12:91272744-91272766 CTTTTCCCTTGAAAAACAAAAGG + Intergenic
1100420515 12:94428372-94428394 CCTTTCTTCTGAAATAGAAAAGG + Intronic
1101664700 12:106801243-106801265 CTTTTCTTGTCAAGAAAGAAAGG + Intronic
1102122593 12:110453954-110453976 TTTTTATTCAGAAGTACAAATGG - Intronic
1102803065 12:115753881-115753903 CATTTCTACTTAAGATCAAATGG + Intergenic
1103484768 12:121275110-121275132 CTTCTCTTGGGAAAAACAAAGGG - Intronic
1103650530 12:122428516-122428538 CTTTTTTTTTAAAGAACAATAGG + Intergenic
1104134973 12:125928758-125928780 CTTTTCTTCTATAAAATAAAAGG + Intergenic
1104609579 12:130217258-130217280 CTTTTCTTCTGAGGAAAATACGG - Intergenic
1104949039 12:132430570-132430592 CTTTTCTTTAAAAGAACAGAAGG - Intergenic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106750660 13:32762957-32762979 CTTTTGTGTTGAATAACAAATGG - Intronic
1107247696 13:38317334-38317356 GTTTTCTACTGAACAAGAAAAGG + Intergenic
1107326258 13:39246200-39246222 CTTTTATTCTGAAGCACACTAGG - Intergenic
1107679032 13:42828808-42828830 CTTTTCTATTGAAGGATAAAAGG - Intergenic
1108075561 13:46675816-46675838 CCTTTCTTCTGAAGAGCAGTGGG + Intronic
1108806202 13:54159414-54159436 TTTGTCTTCTGAAGGACAGAAGG - Intergenic
1109049121 13:57455414-57455436 TTCTTCTTTTGAAGAAGAAAAGG + Intergenic
1109530111 13:63631748-63631770 CCTTTCTTTTGAAGGACTAAAGG + Intergenic
1109851339 13:68068508-68068530 CTTTTCTTCTCAAGTTCACATGG - Intergenic
1110159792 13:72361767-72361789 GTTTTTTTCTTAAGAAGAAAAGG - Intergenic
1110193832 13:72762778-72762800 CTTTTCTTACGAACAAGAAATGG + Intronic
1111251519 13:85607907-85607929 ATTTACTTCTTAAGACCAAAGGG + Intergenic
1111713395 13:91846618-91846640 CTTTTTTACTGAAGACAAAAAGG + Intronic
1112562239 13:100525323-100525345 GTTTTTTTCTGATGAACAACTGG + Intronic
1112715936 13:102185295-102185317 CCTTTCTTCTCATGAACATAAGG - Intronic
1112955696 13:105055525-105055547 CTTCTCTTCTGCATAACAAGAGG - Intergenic
1113402644 13:110008208-110008230 CGTTTCATCTGATGATCAAATGG + Intergenic
1115014845 14:28597970-28597992 CTTTTCTTATTATGAATAAAGGG + Intergenic
1116057267 14:39879101-39879123 TTTTTCATGTGAAGAATAAAAGG - Intergenic
1116612196 14:47089846-47089868 TTTTACTTCTGAAAAAAAAAGGG + Intronic
1116666707 14:47785660-47785682 CTTTTGTATTGAAGAACTAATGG + Intergenic
1116721047 14:48495969-48495991 CATTTCTTCTGAACAAAAAGAGG - Intergenic
1117344943 14:54822578-54822600 CCTTTCTTCTGAAGAAAGACAGG + Intergenic
1117375847 14:55117604-55117626 CTTTTTTTTTAAAGTACAAAGGG + Intergenic
1118674089 14:68163966-68163988 CATTTCTTCTCAAGAAAAATAGG - Intronic
1119106960 14:71933361-71933383 CTTTTCTTCCAAACCACAAATGG - Intronic
1119217271 14:72878744-72878766 CTTTATTTCTCAAGACCAAAGGG + Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1120282904 14:82462090-82462112 CTATTCTTATGAACCACAAAAGG - Intergenic
1120621059 14:86765277-86765299 TTTTTCTGATGAACAACAAATGG + Intergenic
1121325227 14:93015861-93015883 CTTTTCTTCACCAGGACAAAGGG - Intronic
1121386736 14:93534279-93534301 CTTTTCTTTTCAATAAGAAATGG + Intronic
1121895852 14:97646866-97646888 CTTTTTTCCTGCAAAACAAATGG + Intergenic
1122530060 14:102419112-102419134 CTTGTGTTCTGAAGAGGAAAGGG + Intronic
1122604859 14:102941391-102941413 CTTTTCTTCTGAATACAAAAAGG + Intronic
1125103706 15:35946176-35946198 GTTTTGTTTTGAAAAACAAATGG + Intergenic
1125410563 15:39401741-39401763 CTTTTATTTTGAAATACAAATGG - Intergenic
1126043913 15:44620273-44620295 CTTCACTTCAGCAGAACAAATGG - Exonic
1126259826 15:46676271-46676293 CCATTCTCCTGATGAACAAAGGG - Intergenic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1126473171 15:49037720-49037742 CTCTTCTTCTGGGGAATAAATGG + Exonic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1127145390 15:56018186-56018208 CTTCTCTCCTGAAGAGCAAGAGG + Intergenic
1128000751 15:64189244-64189266 ATTTTCTTCTGGAAAGCAAAAGG + Intronic
1128129851 15:65219004-65219026 CCTTGCTTCTGAGGAAAAAAGGG - Intergenic
1128397046 15:67238073-67238095 CGAATCTTCTGAAGAATAAAAGG + Intronic
1128654135 15:69447025-69447047 TATTTCTTCTGAAGAATAAGTGG - Intronic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1130414939 15:83684296-83684318 CATTTCCTCTGAAGACAAAAGGG - Intronic
1131046449 15:89319478-89319500 CTTTTATTCAGAGGAAGAAACGG + Intronic
1131670941 15:94619007-94619029 CTGTTCTTCTGAAATCCAAATGG - Intergenic
1133726419 16:8541913-8541935 CTGTTCTTTCCAAGAACAAAGGG + Intergenic
1134470503 16:14521177-14521199 TTTTTCTTATGAAAAAGAAAAGG - Intronic
1135388180 16:22063575-22063597 ATCTTTGTCTGAAGAACAAAAGG - Intronic
1138137083 16:54532476-54532498 CTTTTCTTGTGCTGAAAAAAAGG + Intergenic
1138600629 16:58051883-58051905 CTGTTCTTCTGCAGAACCAAGGG + Intergenic
1138626580 16:58256754-58256776 CTTTTTTTCTGAACACCAAGAGG - Intronic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1138766756 16:59614276-59614298 CTTTTCATATGGCGAACAAATGG + Intergenic
1138771403 16:59668170-59668192 ATTATCTTTTGAAGAACATAAGG + Intergenic
1138957430 16:61988118-61988140 CTCTTCTCTAGAAGAACAAAGGG - Intronic
1139142780 16:64288192-64288214 CTTTCCATCTGAAGAACTAGGGG - Intergenic
1140347116 16:74224234-74224256 TTTTTCTTATGAAGTACATAAGG + Intergenic
1140636967 16:76926241-76926263 CTTTTCATCTGAAGAGCAGTGGG - Intergenic
1142133134 16:88439942-88439964 CTTTTCTCCCGCAGAGCAAATGG - Exonic
1142722747 17:1787661-1787683 CTCATCTTCTGAGGAACAGAGGG - Intronic
1144235070 17:13252548-13252570 CTTCTCTTCTTATAAACAAAAGG + Intergenic
1145840708 17:27991849-27991871 TTTTACTTCTGGATAACAAAAGG + Intergenic
1147000181 17:37356726-37356748 TTTTTTTTCTGAATTACAAAAGG + Intronic
1148318933 17:46732771-46732793 CTCTTCTCCTGCAGAACACAGGG - Intronic
1148862770 17:50613211-50613233 CTCTCCCTCTGAAAAACAAAGGG + Intronic
1149325845 17:55529135-55529157 CATTTATTCTGAAGAAAAAATGG + Intergenic
1149586865 17:57794960-57794982 CTTTAAATATGAAGAACAAACGG + Intergenic
1149611920 17:57963889-57963911 CTTTCCTTCGTAAGAAGAAAAGG - Intergenic
1150658681 17:67057128-67057150 TTTTTCTTGTGAAGAACATCAGG + Intergenic
1150741889 17:67785793-67785815 CCTTTCATCTGAAGAACCAGGGG + Intergenic
1150871551 17:68917381-68917403 CTTTGTTTCTAAAGAAGAAATGG - Exonic
1151022271 17:70631218-70631240 CTTTTCCTCTGAAAAACAGAAGG + Intergenic
1151131297 17:71899522-71899544 CATTTCTTCTTAAGATTAAATGG - Intergenic
1151274723 17:73025411-73025433 CATGTTTTCTGAAAAACAAATGG - Intronic
1151410330 17:73921643-73921665 CATTTCTTCTGAATCACATAAGG - Intergenic
1153924206 18:9819586-9819608 CTTAATTTCTGAAAAACAAAAGG + Intronic
1155848927 18:30745655-30745677 CTTGTCTTCTACAGAATAAAAGG - Intergenic
1155966240 18:32037990-32038012 GGTTTCTTGTGAAGAGCAAAAGG - Intronic
1156070733 18:33204606-33204628 CTTTACTCATGAACAACAAATGG - Intronic
1156892504 18:42205851-42205873 TTTTTTTTATGAAGAAGAAAAGG - Intergenic
1158142703 18:54272196-54272218 CTGATTTACTGAAGAACAAAGGG + Intronic
1158254422 18:55529994-55530016 GTTAATTTCTGAAGAACAAAAGG + Intronic
1158701393 18:59751343-59751365 CTTTTCTTCAAAGGGACAAATGG + Intergenic
1158788607 18:60746650-60746672 CATTTCCTTTGAACAACAAAGGG - Intergenic
1159338869 18:67108307-67108329 CTTGTTTACTGAACAACAAACGG + Intergenic
1159500449 18:69262200-69262222 CTTATATTTTGAAGATCAAAAGG - Intergenic
1159567186 18:70064971-70064993 TTGATCTTCTTAAGAACAAAAGG - Intronic
1159603436 18:70450746-70450768 ATTTTCTTCTTAAAAAAAAAAGG - Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1162633186 19:11945004-11945026 CTTTTCTTCTTTAGAATAAGTGG + Intronic
1165342776 19:35224587-35224609 CCCTCCTTCTGAAGAACACAGGG + Intergenic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1168668607 19:58224016-58224038 CTTTTCTTCTGAATATTAAAGGG - Intergenic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
926164343 2:10510100-10510122 GTTGTCTTTTGAAGCACAAAAGG - Intergenic
927337017 2:21936844-21936866 CTTTAAATCTGAAGAAAAAAAGG - Intergenic
927556913 2:24041507-24041529 CTTTTCTTTTAAACAAAAAATGG + Intronic
927606320 2:24490607-24490629 CTTTTCATCTGTAAAACGAAGGG + Intergenic
928732804 2:34252402-34252424 CTTTTCCACTGAAGAAAAACTGG - Intergenic
928750444 2:34464568-34464590 CCTTTCCTCTCAAGAAGAAAAGG - Intergenic
928750446 2:34464569-34464591 CTTTTCTTCTTGAGAGGAAAGGG + Intergenic
929009164 2:37424058-37424080 CTTTTCCTCTGAAGGAGAAAGGG + Intergenic
930144765 2:47990805-47990827 CTTTTCTTCTGAGTTACAGAAGG - Intergenic
931057156 2:58485495-58485517 CTTTTCTTGACTAGAACAAAAGG - Intergenic
932895198 2:75632693-75632715 CTTTTCTTCTTAACAGCAAAAGG + Intergenic
933152140 2:78928398-78928420 CTTTCCTTGTGAAGAAAGAAAGG + Intergenic
934067698 2:88354727-88354749 CTTTCCCTCAGAAGACCAAAAGG + Intergenic
934232898 2:90202118-90202140 CTTTTCTGGTGAAAAAAAAAAGG + Intergenic
935042203 2:99443073-99443095 TTTTAGTTCTGAAGTACAAAAGG - Intronic
935589936 2:104836766-104836788 CTTTGCTTCTGAATAACGCATGG + Intergenic
935856581 2:107281260-107281282 GTTTTCTGCTTAGGAACAAAAGG + Intergenic
936509066 2:113131027-113131049 CTTTTCTGGGGAAGAACAGAGGG - Exonic
937475243 2:122209305-122209327 CCTTTCTTCTGAGAAACAAATGG + Intergenic
937622510 2:124004981-124005003 ATTTGCTGCTGAAGGACAAACGG + Intergenic
939249751 2:139668582-139668604 TCTCTCTTCTGAAGTACAAATGG + Intergenic
939371581 2:141308037-141308059 CACTTCTTCTGAAGACCATAAGG - Intronic
939626989 2:144489903-144489925 CATTCCTTCTGAAACACAAACGG + Intronic
940160669 2:150709325-150709347 CTTTCCTACTGATGATCAAATGG + Intergenic
942986532 2:182149664-182149686 CTTTTTTTATGAAGTACTAAGGG - Intronic
943019000 2:182550540-182550562 CCGTTCTACTGAAGAAAAAAAGG + Intergenic
943091245 2:183377220-183377242 CTTTTCTGCTGAAAAACATCTGG + Intergenic
943197021 2:184766041-184766063 CATTTCTTTTAAAGAAAAAATGG + Intronic
943456457 2:188113838-188113860 CCTTTCTTCTCTAAAACAAAGGG - Intergenic
943826407 2:192399335-192399357 CTTTTCTTTTCATGAACAAATGG + Intergenic
944190264 2:196995601-196995623 TTTTTCTTCTCAACAACAAATGG + Intronic
944572573 2:201059420-201059442 CTGTTCTACTGAAGAAGACATGG - Intronic
944656326 2:201879966-201879988 CCTCCCTTCTGAAAAACAAAGGG - Intronic
944878457 2:203986824-203986846 CTTCTCTTATGTAGACCAAATGG + Intergenic
945703197 2:213197658-213197680 CTTTCCATCTGAAGGAGAAAGGG + Intergenic
945724604 2:213460994-213461016 CTATTCTTCTGAGGTAGAAATGG - Intronic
946579600 2:221113539-221113561 TTTTTCTTCTGCAGCACAGAAGG - Intergenic
946671951 2:222114557-222114579 CTTTTCCTTTCAAGAACAGATGG - Intergenic
947645723 2:231738064-231738086 TTTTTCTTCGACAGAACAAATGG - Exonic
1169912289 20:10656795-10656817 CTTTTCATTAGAAGAAAAAAAGG + Intronic
1170032517 20:11957846-11957868 TTTTTCATCTGTACAACAAAGGG - Intergenic
1170861358 20:20106559-20106581 CTTTTCTTCTGAAGACCTCCAGG - Intronic
1171080646 20:22179778-22179800 TCTTTCCTCTGAAGAACAATGGG + Intergenic
1171142929 20:22758550-22758572 CCTTTCTGCTGAAGGACACAAGG + Intergenic
1172153743 20:32809373-32809395 CTTTTCTTCTGCAGGTCAGATGG + Intergenic
1173143304 20:40503465-40503487 CTTTTCTGATGCAGAACAATGGG - Intergenic
1173567220 20:44050382-44050404 CTTTCCTAATGAAGAAAAAATGG + Intronic
1173790524 20:45824930-45824952 TTGTTCTTCTGGAGAACCAAGGG - Intronic
1176979391 21:15362668-15362690 TTTAGCTTCTGAAGAACATAAGG - Intergenic
1177206817 21:18019845-18019867 CTTTTCTTCTGATCAAGAATGGG - Intronic
1177291853 21:19122890-19122912 ATTTTCTTTAGAATAACAAATGG - Intergenic
1177416585 21:20801113-20801135 AAGTTCTTCAGAAGAACAAAGGG - Intergenic
1177653650 21:23988295-23988317 TTATTCTTCTGAATAACTAATGG - Intergenic
1177698952 21:24611895-24611917 CTCTTTTTCTGAAGATCAAAAGG - Intergenic
1177903244 21:26943477-26943499 CTTATCTTCTGTGGAACCAAAGG + Exonic
1178068173 21:28930502-28930524 CTTTTCTTTTTCAGTACAAATGG - Exonic
1178254874 21:31043437-31043459 TTTTTTTTCTGAGGAAAAAATGG + Intergenic
1178514357 21:33233660-33233682 TTTTTTTCCGGAAGAACAAAGGG + Intronic
1181897185 22:26120602-26120624 CCTTCCTCATGAAGAACAAATGG - Intergenic
1184474961 22:44715391-44715413 CTCTTCTCCTGAATAACAAGGGG - Intronic
1184976992 22:48069381-48069403 ATTCCCTTCTGGAGAACAAAGGG + Intergenic
949778366 3:7657112-7657134 CATTTCTGCTGAAGAACATCGGG - Intronic
949897033 3:8775588-8775610 CTGTTCTTTTGCAGAAGAAAGGG + Intronic
950762132 3:15240644-15240666 GTTTTTTTTTGAAGAATAAATGG - Intronic
951065823 3:18264459-18264481 AGTTTCAGCTGAAGAACAAAAGG + Intronic
951106391 3:18748425-18748447 TTTTCATTCAGAAGAACAAAAGG - Intergenic
951356649 3:21675190-21675212 GTTTTCTTCAGAAAAATAAATGG + Intronic
953915809 3:46920568-46920590 CTTTTTTTCCTATGAACAAAAGG - Intergenic
954872160 3:53775862-53775884 TTTTTCAGATGAAGAACAAAGGG - Intronic
954941607 3:54378122-54378144 CTTTCATTTTGGAGAACAAATGG + Intronic
956130033 3:66044375-66044397 CTTTTGGTCTGAGGAACCAAGGG + Intergenic
956226756 3:66968835-66968857 CTTTACATCTCAAGAAGAAAAGG - Intergenic
956321602 3:68003602-68003624 CTATATTTCTGAAGAAGAAAGGG + Intergenic
957546476 3:81644586-81644608 CTTTTATTCTGAAGGAGACAGGG + Intronic
958002798 3:87772468-87772490 ATGTTCTTCTGAAGCACACAAGG + Intergenic
958497952 3:94869037-94869059 CTTTTCTGCTGAAGATAAAGAGG - Intergenic
958995331 3:100898109-100898131 ATTTTCTTTGGAAGAACAAATGG - Intronic
959010037 3:101064667-101064689 AATTTGTTCTGAAGAACAGATGG + Intergenic
959082472 3:101816627-101816649 CTTTTCTCCTGATTAAAAAAAGG - Intronic
959800837 3:110494000-110494022 CTTTTCTCCAGTAGTACAAAGGG + Intergenic
960170884 3:114459620-114459642 ATTTACTCATGAAGAACAAAGGG - Intronic
960295306 3:115935656-115935678 CTTTTCATCTAAAAGACAAAAGG - Intronic
960495704 3:118371582-118371604 CTTTGCTTCTAAAGAACAGTTGG + Intergenic
961500724 3:127332340-127332362 ATTTTCTTCTCAAGCACACATGG + Intergenic
961944151 3:130668931-130668953 ACATTCTTCTGAAGAACATATGG + Intronic
964595003 3:158416015-158416037 TTTTTATTCTGAAGATCAGAGGG + Intronic
964670441 3:159219518-159219540 CTCCTCTTCTGAACATCAAATGG - Intronic
964947133 3:162239555-162239577 ATTTTCATCTAAAGAATAAAGGG - Intergenic
965486875 3:169288955-169288977 CTTTTTTTATGAAAGACAAAAGG + Intronic
965489788 3:169321906-169321928 ATTTCTTTCTGAAGAACACAGGG + Intronic
965761853 3:172086384-172086406 CTTTTAATATAAAGAACAAATGG + Intronic
966047815 3:175574290-175574312 TGTATTTTCTGAAGAACAAAGGG + Intronic
967247966 3:187507486-187507508 TTTGTCTTCTGAACAACAAAAGG - Intergenic
967258721 3:187620665-187620687 CTTGTCTTCAGCAGAACAAAAGG - Intergenic
967426054 3:189328754-189328776 TATTTCTTCTAAAAAACAAATGG + Intergenic
967543382 3:190694961-190694983 CCTTTCCTCTGAAAAAAAAAGGG + Intergenic
967592177 3:191291275-191291297 CATGTCTTTTGAAGAACAAAGGG + Intronic
967741938 3:193012933-193012955 ACATTCTTCTCAAGAACAAAAGG - Intergenic
967753002 3:193136056-193136078 ATTTTATGCTGAAGAACAAAAGG + Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
970091916 4:12419101-12419123 TTTTTCTACAGAAGAGCAAATGG + Intergenic
970158363 4:13164296-13164318 CTTTTATTTTGAAGAAGAAAGGG - Intergenic
971808431 4:31391680-31391702 CTTTTTTTCTGAAAAACAATTGG - Intergenic
972681995 4:41315182-41315204 ATTTTCTTCTAAAAAATAAAGGG - Intergenic
972894111 4:43597858-43597880 CTTTTCTTCTGAAAAATTTAGGG + Intergenic
973066097 4:45795241-45795263 CTTTTCTACTGAATACCATAAGG - Intergenic
973264520 4:48198143-48198165 CTTTTCATCTGAAGAACCAGTGG + Intronic
973607373 4:52600820-52600842 TTATTCTTTTGAAGAACACAGGG - Intronic
973644064 4:52932656-52932678 CTCTTCTTCTAAGAAACAAAGGG - Intronic
974054642 4:56973312-56973334 CTTGTATTCAGAAGAACAGAAGG - Exonic
974097722 4:57383284-57383306 CTTTTCTTCTAAACTTCAAATGG - Intergenic
974120618 4:57633639-57633661 CTTTTCTTCTAAAGGTCAGATGG + Intergenic
974788061 4:66647543-66647565 TATTTCCTCTGAAGAACAAAAGG - Intergenic
975164276 4:71160344-71160366 TTTTTCTTTTCAAGAACACAAGG + Intergenic
975412073 4:74065046-74065068 CCTTTCTGCTTAGGAACAAAAGG - Intergenic
975938590 4:79612491-79612513 CTTTTCTTTTGAGTAGCAAATGG - Intergenic
975950781 4:79768460-79768482 CTTTCCATCTAAAGAACTAAGGG + Intergenic
976099630 4:81547402-81547424 ATTTTTATCTGCAGAACAAAAGG - Intronic
976939657 4:90684336-90684358 CATATCTTCTGAGGATCAAATGG + Intronic
977053194 4:92156146-92156168 CATTCCTTCTGCACAACAAAGGG + Intergenic
977357939 4:95969877-95969899 TTTCACTCCTGAAGAACAAAGGG + Intergenic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
978131800 4:105207321-105207343 CTCTCCTTTTGAAGTACAAAGGG + Intronic
978760333 4:112350549-112350571 TTTATCTTCAGAAGAAGAAATGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979207420 4:118056330-118056352 CTTAACTTCTGGAGCACAAATGG - Intronic
979465396 4:121031843-121031865 GTTTTCTTCTGTAGCATAAAGGG + Intergenic
979508328 4:121523556-121523578 TTTTTCTTTTTAAGTACAAAAGG - Intergenic
979645754 4:123066442-123066464 TGTTTCTTCTGAAAAATAAAAGG - Intronic
979707917 4:123743477-123743499 TGTTTTTTCTGGAGAACAAATGG + Intergenic
979762052 4:124418388-124418410 GTTTTTTTCTAAAGAACATAGGG + Intergenic
980328845 4:131384880-131384902 ATCTTCTTTTGAAGAAGAAAAGG - Intergenic
982844948 4:160239663-160239685 GCCTTCTTCTCAAGAACAAATGG - Intergenic
982890211 4:160838149-160838171 CTTTTCATCTGAAGACAAATGGG - Intergenic
983638504 4:169922642-169922664 TTTTTCTCCTGAAGCACAAAAGG + Intergenic
983772383 4:171568155-171568177 GTATAATTCTGAAGAACAAAAGG + Intergenic
984966529 4:185144651-185144673 TTTTTTTTTTGAAGAAAAAAAGG - Intronic
985235589 4:187870264-187870286 CTTTTATTCTGAAGTTTAAATGG + Intergenic
985945435 5:3178701-3178723 ATTTTCATGTGAAGAACAAGTGG - Intergenic
986593732 5:9398637-9398659 CTTTTCATCTGAAGGGCAGAAGG - Intronic
986623342 5:9699967-9699989 CTTTTTTTCTGAAGAACTTTGGG - Intronic
987645307 5:20663436-20663458 ATTTTCTTCTGAAGAACATATGG + Intergenic
988174206 5:27700021-27700043 TTTTTCTTCTTAAAAACAGATGG - Intergenic
988248644 5:28724495-28724517 ATTTTATTCTGAAACACAAAGGG - Intergenic
988521148 5:31946647-31946669 CCTTTCCTTTGAAGAAAAAAAGG - Intronic
988550728 5:32198554-32198576 CTTTTCTCATGAGGAACAAGTGG - Intergenic
989500051 5:42156183-42156205 ATTTTTTTCTGAAAAGCAAAAGG - Intergenic
989666065 5:43855489-43855511 CTTTGTTTCTGAAGAAGTAAAGG - Intergenic
989739351 5:44751907-44751929 CTATTGTTCTGAAAATCAAATGG + Intergenic
990805815 5:59660339-59660361 CTTTTTGTCTGAAGCCCAAATGG - Intronic
990979140 5:61586123-61586145 CTTTCGGTCTGAAGGACAAAGGG - Intergenic
991359079 5:65801645-65801667 AATGTCTTCTAAAGAACAAAAGG - Intronic
992082293 5:73246455-73246477 CCATTCTTTTGAAAAACAAACGG - Intergenic
992093033 5:73336258-73336280 TTTATCTTTTGATGAACAAATGG - Intergenic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
993279470 5:85907512-85907534 CTTTAATTCAGAAGAAAAAATGG + Intergenic
995210681 5:109534319-109534341 AATGTCTTCTGAAAAACAAAAGG - Intergenic
995280496 5:110330491-110330513 CTTTTCATCTGGAGACTAAAGGG - Intronic
996339496 5:122420700-122420722 CTTCTCTCCTCAAGAACACATGG - Intronic
996383261 5:122884019-122884041 TGTTTCTTCCGAAGAACCAATGG - Intronic
996417424 5:123225546-123225568 CTTTTCTTTTGAAAAATAAATGG - Intergenic
996610687 5:125375998-125376020 CTTTTCATGTGAAAAATAAATGG + Intergenic
999316530 5:150587877-150587899 CTTTTCTTCTAAAGAGAAAATGG - Intergenic
999586699 5:153097025-153097047 CTTTTCTACCAAATAACAAATGG + Intergenic
999678510 5:154031922-154031944 CCTTTCTGCTTAGGAACAAAAGG - Intronic
999965290 5:156802925-156802947 ATTTTCTTCTCTAAAACAAAGGG + Intergenic
1000016766 5:157284932-157284954 ATATCCTTATGAAGAACAAAAGG + Intronic
1000127509 5:158260852-158260874 TTTTTCTTTTGATGAACAATTGG + Intergenic
1000292927 5:159888030-159888052 CTTTTCTCCTGAAAAATAAATGG - Intergenic
1000751637 5:165102176-165102198 CTTTTCTCCTGATGAGAAAATGG - Intergenic
1000950072 5:167470782-167470804 CTTTTCTTCTGAATTGTAAATGG - Intronic
1001802966 5:174559455-174559477 TTATTCCTCTGAAGCACAAAGGG - Intergenic
1002983791 6:2168169-2168191 CTTTCCTTCTGAGGAAGGAAGGG - Intronic
1003129901 6:3386654-3386676 CTTTTCATCTGTAGAGCAAGAGG - Intronic
1003251137 6:4430057-4430079 CTTTTCTTCTGTAGAGACAAAGG - Intergenic
1003377787 6:5595208-5595230 CTTTTTCTCTGAAGAGCTAAAGG - Intronic
1003967530 6:11267282-11267304 CTTATCATGTGAAGGACAAATGG + Intronic
1004069272 6:12283045-12283067 CTTTCCATCAAAAGAACAAATGG + Intergenic
1004287013 6:14330440-14330462 GGTTTCTTCTGAAGACCAACAGG + Intergenic
1004963405 6:20819502-20819524 CTGTTTTTCTGATGATCAAATGG + Intronic
1007898765 6:45390395-45390417 TTTTTCTTCTGAACAACTACAGG + Intronic
1008168518 6:48171184-48171206 TTATTCATCTGAACAACAAAGGG + Intergenic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1010985890 6:82423648-82423670 TTTTGTTTCTGGAGAACAAAAGG - Intergenic
1011132480 6:84065585-84065607 CTTTTCCTCAGAAGAACCAATGG + Intronic
1011759965 6:90553057-90553079 CTTTTCTCCTGAAGAAGCAAGGG - Intronic
1012215528 6:96578336-96578358 TTTTTCTTCTTAAGAAAACAAGG + Intronic
1012348868 6:98226305-98226327 TTGTTCTTCTGAAAAAGAAATGG - Intergenic
1012443023 6:99279549-99279571 CTTTGCTTCTGACCAACATAAGG - Exonic
1012841549 6:104334677-104334699 CTTATCATTGGAAGAACAAAAGG - Intergenic
1013020769 6:106215085-106215107 ATTTTCCTCTGAAGAATCAAAGG + Intronic
1013168022 6:107611099-107611121 CTTTACTTCTGAAGGTCAAATGG + Intronic
1013532572 6:111033643-111033665 CTTTTTTTCTGATAATCAAAGGG + Intergenic
1014208684 6:118685161-118685183 CTTATATTCTTAAAAACAAAAGG - Intronic
1014453706 6:121612778-121612800 TTTTTTTTCTAAACAACAAATGG + Intergenic
1014651965 6:124050935-124050957 CTTTCCCTTTGAAAAACAAAAGG - Intronic
1014878886 6:126696948-126696970 CATTTCTACAGCAGAACAAAAGG + Intergenic
1014984998 6:127995037-127995059 CTTTTCTTGTGTAGAAAAACAGG - Intronic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1016633358 6:146257972-146257994 TTTTTTTACGGAAGAACAAACGG - Intronic
1017187107 6:151612735-151612757 CTTTTCTTCTTAGGAAAGAAGGG + Intronic
1017582063 6:155876790-155876812 CTTTACTTCTGGAGAACATCAGG - Intergenic
1017599413 6:156064299-156064321 CATTTCTGCAGAAAAACAAAAGG + Intergenic
1019362189 7:610539-610561 CATTTCCTCTGAAGAAAAATGGG - Intronic
1019805022 7:3117445-3117467 CTTTTCTTCTGATAAATGAAGGG - Intergenic
1020459328 7:8411014-8411036 ATTTTCTTCCAAAGAACATAAGG + Intergenic
1020565175 7:9786656-9786678 CTTTCCATCTGAAGAATTAAAGG + Intergenic
1021254802 7:18377861-18377883 CTTTAAATCTGGAGAACAAAAGG - Intronic
1021263727 7:18492864-18492886 TTTTTCTTCTGAGAAACAAGTGG + Intronic
1021478777 7:21092866-21092888 CTTTTCTTCTGGAGAAGACAAGG - Intergenic
1021902982 7:25306055-25306077 CTTTTCCTCTGAAGAAACACAGG + Intergenic
1022085617 7:27064595-27064617 CTTTTTTTTTAAAGAAAAAATGG - Intergenic
1022125081 7:27348679-27348701 CATTTCTACTGATGAAGAAATGG - Intergenic
1022361228 7:29660207-29660229 TTTTTTTTCTGAAAAAAAAAAGG - Intergenic
1022378285 7:29835651-29835673 CTTTTCCTCTGAAGAAAACCAGG + Intronic
1022918832 7:34991503-34991525 CTTCTCTTCTGAAGAAGATGTGG - Intronic
1023689974 7:42775576-42775598 CTTTGCTTCTGAAGATTAGATGG - Intergenic
1024489709 7:49966387-49966409 ATATTCTTTTGAAGTACAAATGG + Intronic
1024697152 7:51869447-51869469 TTTTTTTTTTGAAGAACATATGG + Intergenic
1026587946 7:71672098-71672120 CTTTTATTTTGGAGAAGAAAAGG - Intronic
1026736130 7:72949845-72949867 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1026786473 7:73304746-73304768 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1027107597 7:75415213-75415235 CTGCTCTTCTGAAGAACCAAGGG + Intergenic
1027568624 7:79831764-79831786 CTTTTCTTTTAAAGAAAATAAGG + Intergenic
1027629391 7:80583828-80583850 CTTTTCAAAAGAAGAACAAATGG + Intronic
1028000030 7:85482770-85482792 CTTTTCTTTTTAACAATAAATGG + Intergenic
1028823496 7:95241684-95241706 CATTTCTCTTGAAGAAAAAATGG + Intronic
1029832067 7:103271949-103271971 CTTTTTTTCTGAAAAAAGAAAGG + Intergenic
1030768810 7:113446976-113446998 GTTTTCTTCTGAAGTATAAATGG + Intergenic
1031118586 7:117694926-117694948 TTTTGCTTCTGAAGACCAGACGG + Intronic
1031142407 7:117957716-117957738 TTTCTCTTCTGAAGAATAATGGG + Intergenic
1031383540 7:121117841-121117863 TCTTTCTTCTGAAGAGCAGAAGG - Intronic
1031514649 7:122687060-122687082 CCTTTCTGCTGAAGTTCAAAAGG - Intronic
1031571785 7:123368414-123368436 CTGTTATTTTGAAGAACAGAGGG + Intergenic
1032462787 7:132124239-132124261 CTTTTCATTTTAAGAACAGAAGG + Exonic
1032633479 7:133680089-133680111 TTTTACATCTGGAGAACAAATGG + Intronic
1033252849 7:139776199-139776221 CTTTGATTCTGAAGAACACAAGG - Intronic
1033910108 7:146252720-146252742 CTTTTCTTTTTAAGAATATAAGG - Intronic
1034024085 7:147678918-147678940 CTTTTCTTCAGAAAACCATAGGG + Intronic
1034588859 7:152121535-152121557 CTTTTTTTCAGAAAAACAATCGG + Exonic
1035208404 7:157309849-157309871 GCTTAGTTCTGAAGAACAAAGGG + Intergenic
1036138824 8:6187413-6187435 CAATACTTCTGAAGAACTAATGG - Intergenic
1037036237 8:14170927-14170949 CATTACTTTTGAAGAAAAAAAGG + Intronic
1037149087 8:15613868-15613890 ATTTTCTTCAGAAGACCAAAAGG + Intronic
1037470159 8:19200731-19200753 ACTTTCTTCTAAAGAAGAAAAGG - Intergenic
1038026026 8:23591501-23591523 CTTTTCTTCTGAATTAAAGATGG + Intergenic
1038079892 8:24122267-24122289 CTTCTCTTCTGGAGAGGAAAAGG + Intergenic
1038139745 8:24831235-24831257 CTTTTATTCTGAAATAGAAAAGG + Intergenic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1039121562 8:34153400-34153422 TTTTGCTTTTGAAGAAGAAATGG + Intergenic
1039577173 8:38632886-38632908 CTTTTCTTGGGAAGCAGAAAGGG + Intergenic
1039841493 8:41296491-41296513 TTTTTTTCCAGAAGAACAAATGG - Intronic
1040021823 8:42747619-42747641 CATTTGTTCAGAAGAACCAAAGG - Intergenic
1040730904 8:50445820-50445842 CTTTCCTACTGAAGTATAAATGG - Intronic
1040751808 8:50718574-50718596 CTTTTCTTGTAAAGGGCAAAGGG + Intronic
1041271273 8:56111588-56111610 CTGTTCTTCAGAAAAGCAAAAGG - Intergenic
1041586162 8:59522355-59522377 CCTTTCTTTTCAAGAACAAATGG + Intergenic
1041607483 8:59799744-59799766 CTTTTCTTAGGAAAAAAAAATGG + Intergenic
1042491722 8:69407171-69407193 CTGATCTTCTGTAGAGCAAAGGG + Intergenic
1042548768 8:69974662-69974684 CTTTTCTTCTGGTGACCAATAGG - Intergenic
1043697951 8:83245121-83245143 ATTCTCTTCTAAAGAATAAATGG + Intergenic
1044388834 8:91624461-91624483 CTTTTCTTCTGAAGACAATATGG + Intergenic
1044927615 8:97222934-97222956 CTTTTCTGCTGAAGAATATTTGG + Intergenic
1045007073 8:97925800-97925822 CATTTCATCTGGAGACCAAAGGG - Intronic
1045835336 8:106513952-106513974 CTTTTCTTCTCAAAAGCAGAAGG + Intronic
1046545816 8:115648635-115648657 TTTTTCTTCTTAAAAACAAAAGG + Intronic
1047021395 8:120778478-120778500 CTTTTCATTTTCAGAACAAAAGG + Intronic
1047151049 8:122263476-122263498 ATTTTTTTCTGTAGAACAACTGG - Intergenic
1047945397 8:129872129-129872151 CTATTCTGCTGATGAACAGAAGG + Intronic
1047970984 8:130084281-130084303 CTTTTCTTCTCAAGCACAGCAGG - Intronic
1050605608 9:7297907-7297929 CTTTTTATCTGAACAACAAATGG - Intergenic
1051579249 9:18652941-18652963 CTTTTCCTCTCAAGAACACATGG - Intronic
1052008414 9:23377948-23377970 TTTTTCCTCTGGAGAACAGATGG - Intergenic
1052681107 9:31693904-31693926 CTTTCCTTCTGAGGATAAAATGG - Intergenic
1053456491 9:38236936-38236958 ATTTTCCACTGAAGGACAAAGGG - Intergenic
1053610882 9:39711929-39711951 CTTTGCTTGGAAAGAACAAATGG + Intergenic
1053868919 9:42469951-42469973 CTTTGCTTGGAAAGAACAAATGG + Intergenic
1054087372 9:60759229-60759251 CTTTGCTTGGAAAGAACAAATGG - Intergenic
1054242640 9:62630466-62630488 CTTTGCTTGGAAAGAACAAATGG - Intergenic
1054556764 9:66664984-66665006 CTTTGCTTGGAAAGAACAAATGG - Intergenic
1055481068 9:76709726-76709748 CTTTTCTTCTTCAGAACTACTGG - Exonic
1056017495 9:82405894-82405916 CTTTTGTTTTGAAGACCAATAGG + Intergenic
1056670124 9:88620264-88620286 CCTTCCATCTGAAGAACCAAGGG - Intergenic
1057535377 9:95897949-95897971 CTTTTTTGCTGTAGAAGAAAGGG - Exonic
1057746035 9:97752131-97752153 CTTTTCTTTTGAAGGAAAAAGGG + Intergenic
1058115792 9:101082715-101082737 CTTTACTCCTGAATAACACATGG - Intronic
1058482416 9:105409902-105409924 CTATTCTTCTGAAGTGCACATGG + Intronic
1059237485 9:112773982-112774004 CCTTTCTTCTGAAGACAAACAGG - Intronic
1059585877 9:115605763-115605785 CATCTCTTCAGAAAAACAAAAGG - Intergenic
1060384508 9:123212045-123212067 CTTTTCTTATTCAGAGCAAAAGG - Intronic
1060616693 9:125023002-125023024 TGTTTCTTCTGAAGAATAAATGG + Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1061710292 9:132482742-132482764 TTTTTTTTCTTAAGAACACATGG + Intronic
1061836717 9:133334304-133334326 TTTTTTTTCTTAAGAGCAAAGGG + Intronic
1061850207 9:133410498-133410520 CTTTCCATCTGAAGAACCAGGGG + Intronic
1186030442 X:5363302-5363324 TTTTTCTGCTGAACATCAAAAGG + Intergenic
1186836859 X:13447002-13447024 CTTCTCTTGTTAAAAACAAAGGG + Intergenic
1186844779 X:13519736-13519758 ATTTTTTTCTGAAGGACAGAGGG + Intergenic
1186966761 X:14795673-14795695 ATTTTCTTCTGAAAATCAAGGGG + Intergenic
1187063476 X:15810385-15810407 CTTCTCTTCTGCAGAATATATGG - Intronic
1187593228 X:20741719-20741741 CTATCCTTTTGAAGAACACATGG + Intergenic
1188125138 X:26358090-26358112 TTTTTCTCTAGAAGAACAAAAGG - Intergenic
1188283318 X:28297595-28297617 TTTTTCTTCTGAAGACCCAAGGG - Intergenic
1188858832 X:35231622-35231644 CTTTTCTTCTTATGTTCAAAGGG - Intergenic
1190968792 X:55329104-55329126 CTTTTCTACTGAAAAAAATAAGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1192784626 X:74324365-74324387 CTTTTCTTGGGAGGAAGAAAGGG + Intergenic
1192804001 X:74493970-74493992 CTTTTCTTGGGAGGAAGAAAGGG - Intronic
1193846035 X:86472096-86472118 CTCTTCTTCAGAGGAATAAATGG + Intronic
1194051804 X:89078530-89078552 TTATTTTTCTGAAGAAAAAAGGG - Intergenic
1194204264 X:90993562-90993584 GTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1194304797 X:92230722-92230744 CTTTTCATCTGAAAAGTAAAAGG - Intronic
1194791660 X:98158790-98158812 CTTTTATTTTTAAGAACACATGG + Intergenic
1195219926 X:102737115-102737137 TTATTTTTCTGAAGAAAAAAAGG - Intronic
1195286376 X:103388681-103388703 GGTCTCTTCTGAGGAACAAATGG - Intergenic
1195485640 X:105402583-105402605 CTTTGTTCCTGAAGGACAAACGG + Intronic
1195937022 X:110135228-110135250 CTTTTCTTCTAAAAAAAAAAAGG + Intronic
1196735563 X:118978218-118978240 CTTTTCTACTGGAGATCAAAAGG - Intronic
1196970757 X:121105909-121105931 CTTTTCTTCCCAGGAACATAGGG + Intergenic
1197005849 X:121496665-121496687 ATTTGCTTCTGAAGAATTAAAGG + Intergenic
1197009749 X:121546063-121546085 ATTTTATTTTGAAGAACAATTGG + Intergenic
1198486269 X:137090515-137090537 CTTTTCCTCTGAAGAGTATAAGG + Intergenic
1198915634 X:141668451-141668473 TTTCTCTACTGAAAAACAAAGGG - Intronic
1198944092 X:141990509-141990531 CTTTTCTTGTGCAAAACAAAAGG + Intergenic
1200550103 Y:4569000-4569022 CTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1201601183 Y:15730234-15730256 TCTTTCTTTTGAGGAACAAAAGG - Intergenic