ID: 1038733127

View in Genome Browser
Species Human (GRCh38)
Location 8:30145323-30145345
Sequence CTTAAGAACCTGCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038733127 Original CRISPR CTTAAGAACCTGCCTCCAGC TGG (reversed) Intronic
900645804 1:3708190-3708212 CTGCAGAACCTGCCTCCTCCAGG + Intronic
900653549 1:3743325-3743347 TTTCAGAAGCTGCCTCCGGCGGG + Intergenic
901764591 1:11491778-11491800 CTTGGGGACCTGCCTACAGCAGG + Intronic
904623285 1:31788489-31788511 CCTCAGAAACTGCGTCCAGCCGG + Intergenic
907496210 1:54846516-54846538 CTTCAGAACCTGGTTGCAGCAGG - Intergenic
919917944 1:202150595-202150617 AATTAAAACCTGCCTCCAGCAGG - Intronic
920074410 1:203325990-203326012 GCTGAGAACCTGCCCCCAGCTGG - Intergenic
920335047 1:205239431-205239453 CTTGTGACCCTGCCTCAAGCTGG + Intronic
920647194 1:207812365-207812387 GTTCAGAACCAGCCTCCTGCAGG + Intergenic
920666370 1:207965532-207965554 CTTCAAAAGCTGCCACCAGCTGG + Intergenic
924697425 1:246415011-246415033 GTCAAAAACCTGGCTCCAGCCGG - Intronic
1062946718 10:1466986-1467008 CTGAAGGACCGGCCTTCAGCAGG + Intronic
1064201788 10:13290693-13290715 TTTAATAACCTTCCTCAAGCTGG - Intronic
1066439666 10:35426334-35426356 CTTAATAACCTGCTGACAGCTGG - Intronic
1067098276 10:43316485-43316507 ATTCAGAGCCTGCCTACAGCCGG + Intergenic
1069818818 10:71215054-71215076 CTTAGAAACCTGCCTTCAGGAGG + Intronic
1072469337 10:95697701-95697723 CTTAAGAACCTTCTTGCTGCTGG - Intergenic
1075440528 10:122476393-122476415 GTTAACCACCTGCCTCCATCTGG + Intronic
1075619130 10:123912677-123912699 TTTCAGAGCCTTCCTCCAGCCGG - Intronic
1077067415 11:648489-648511 TTTAAAAAGCTGCCTTCAGCTGG - Intronic
1077130385 11:969143-969165 CCTCAGAGCCAGCCTCCAGCAGG - Intronic
1077785957 11:5383766-5383788 CTAAAGACCATGGCTCCAGCTGG - Intronic
1080840212 11:35977093-35977115 CTGAATTACCTACCTCCAGCAGG - Intronic
1083280444 11:61623745-61623767 CGTAAGACCCTCGCTCCAGCGGG + Intergenic
1086886310 11:92209962-92209984 CATAAGAACATGCCCCCAACTGG - Intergenic
1088848025 11:113683791-113683813 CTTACGAACCTGCCTAGAGGTGG + Intergenic
1089125008 11:116170743-116170765 CTTGAGACCCAGCCCCCAGCTGG - Intergenic
1090451607 11:126811128-126811150 CTTAAGAGCCTGGCTGCTGCGGG - Intronic
1093069206 12:14690835-14690857 CTTAAGAACATCCCTGCAGCTGG - Intronic
1099933039 12:89095484-89095506 ATTAAGAACCTGTCAGCAGCAGG + Intergenic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1104709413 12:130974929-130974951 CTTAAGAACATGTCCCCAGAAGG - Intronic
1108319634 13:49276061-49276083 TTTAAAAACATGGCTCCAGCTGG - Intronic
1111546601 13:89746176-89746198 CTGAAGTTCCTGCCTCCAGTTGG - Intergenic
1112407297 13:99132513-99132535 CTTAGGAAGCTGCAGCCAGCTGG - Intergenic
1113370206 13:109717623-109717645 CTTAAGGATTTACCTCCAGCAGG + Intergenic
1115110023 14:29810694-29810716 CTTAAGAAAATGCTTCCAGGTGG + Intronic
1117925973 14:60779490-60779512 CTTAAGAAGCTGTTTCCGGCTGG + Intronic
1119391021 14:74290967-74290989 TTAAAGACCCTGCCTCCAGCTGG - Intronic
1119752678 14:77091236-77091258 CTACAGAAAATGCCTCCAGCTGG - Intergenic
1120542174 14:85764076-85764098 CTTAAGAAGCTATCTACAGCTGG + Intergenic
1122161490 14:99787624-99787646 CTTAAGAATGTGCCACCAACTGG + Intronic
1124251748 15:28110863-28110885 CTTCAGCCCCTGCCACCAGCTGG + Intergenic
1124270248 15:28274226-28274248 GGTAAGAACCAGCCTCAAGCAGG + Intronic
1125973906 15:43934584-43934606 TTTTAGAAACTGCCTCTAGCAGG + Intronic
1129159502 15:73739531-73739553 CTTTAGAGCCCGCCTCCTGCAGG + Exonic
1129719321 15:77869448-77869470 TTTACGAGTCTGCCTCCAGCCGG + Intergenic
1129821108 15:78602602-78602624 CTTCAGCACCTGGCTCCAGGAGG - Intronic
1130105440 15:80925380-80925402 CTGAAGAACCTGCCCCAAGTGGG - Intronic
1136576837 16:31130245-31130267 CCTGAGCACCTGCCTCCTGCAGG + Exonic
1136848261 16:33593738-33593760 ATTAAGAAACTTGCTCCAGCCGG + Intergenic
1137769462 16:51004434-51004456 CTGAAGAACCTGCTTCAGGCCGG - Intergenic
1138443037 16:57046586-57046608 CCTAAGAACTTGGCTGCAGCTGG - Exonic
1139558086 16:67725274-67725296 CCCAAGAACCTGCCTCCACAAGG + Exonic
1203109968 16_KI270728v1_random:1442387-1442409 ATTAAGAAACTTGCTCCAGCCGG + Intergenic
1142520727 17:502916-502938 CTAAAGAGCCTGGCTCCAGCGGG - Intergenic
1147778055 17:42917803-42917825 ATGAAAAACCTGCATCCAGCCGG + Intergenic
1147962964 17:44178866-44178888 CTTCAGACCCTCTCTCCAGCAGG + Exonic
1148097950 17:45066999-45067021 CATAAGCTCCTGCATCCAGCTGG + Intronic
1148473213 17:47908901-47908923 CTCAACATCCTGACTCCAGCAGG + Intronic
1150160640 17:62894994-62895016 CATGGGCACCTGCCTCCAGCAGG - Intergenic
1152217749 17:79044253-79044275 CTGCAGGACCAGCCTCCAGCAGG - Intronic
1158174483 18:54638821-54638843 CTTAAGAACCTCCATGCAGACGG - Intergenic
1159454936 18:68649385-68649407 CTTAAGAATCTGCCTGCATCTGG - Intergenic
1160853841 19:1207072-1207094 CGTAAGAGCCTTCCCCCAGCAGG - Exonic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163156323 19:15441626-15441648 TTCAAGATCCTGCCTCCATCAGG + Intronic
1164511794 19:28903682-28903704 GGCAAGTACCTGCCTCCAGCTGG - Intergenic
926247270 2:11130735-11130757 TTTAAAAACCAACCTCCAGCCGG + Intergenic
926324264 2:11770834-11770856 CCCAAGAACCTGCCTGCACCAGG - Intronic
926830079 2:16952067-16952089 TTTAAGAACCTGCCCCCAAAAGG + Intergenic
937890712 2:126936461-126936483 CTTAATACCCCGCCTCCATCAGG - Intergenic
939379125 2:141412261-141412283 CTTAAGAAAATGACTTCAGCAGG - Intronic
948975899 2:241463787-241463809 CTTCACCACCTTCCTCCAGCTGG + Intronic
949077159 2:242067712-242067734 CTTAGGAAGCTGTCTCCATCGGG + Intergenic
1172053835 20:32140402-32140424 CTTCAGATCCTGGTTCCAGCAGG - Intronic
1172135338 20:32682931-32682953 TTTAAGAATCTGCCTCCCCCTGG + Intergenic
1173573384 20:44093166-44093188 GTTGAGAACCTGCCCCCTGCTGG + Intergenic
1174803114 20:53581656-53581678 TTTCAGAACCTACCACCAGCTGG - Exonic
1175376908 20:58534105-58534127 CTTAACAACTTACCTCCAACTGG + Intergenic
1175507860 20:59498782-59498804 CTTAAGAGCCTGACTTCTGCAGG + Intergenic
1175826571 20:61939436-61939458 CCTATGAACATCCCTCCAGCTGG - Exonic
1178486890 21:33025201-33025223 CTCAAGTCCCTGCCCCCAGCTGG + Intergenic
1181392233 22:22592026-22592048 CTAAAGAACCTGCCTTCAGCTGG - Intergenic
1181853101 22:25764110-25764132 CCTCAGTACCTTCCTCCAGCTGG + Intronic
1183070027 22:35389789-35389811 CTTAAGGTCCTACCTTCAGCTGG + Intronic
951454806 3:22878521-22878543 CTTGAGAACCTGTCTCCAAATGG - Intergenic
951509166 3:23482411-23482433 CTTAAAAACTTGTTTCCAGCTGG + Intronic
951604630 3:24419401-24419423 CTTAAGGACCTCTCTCCAGATGG + Intronic
952885862 3:38010586-38010608 CGTCAGAGCCAGCCTCCAGCAGG + Intronic
953761432 3:45690064-45690086 CTTAAGAACCTGCTTTAGGCTGG - Intronic
954371706 3:50172409-50172431 CTTGGGAACCTGCCTCCAAGGGG - Intronic
959272000 3:104223597-104223619 CTGAAGAACCTGCCTGAAGCTGG - Intergenic
960387327 3:117035946-117035968 CCCTAGAACCTGTCTCCAGCAGG - Intronic
962155003 3:132936947-132936969 CTAAAGGACCTGTTTCCAGCTGG + Intergenic
962575785 3:136753519-136753541 CTTAAGGGCCTGTCTCCAGTAGG + Intergenic
967993207 3:195146999-195147021 CTTAATATTCTGCCTTCAGCTGG - Intronic
969628747 4:8322978-8323000 CCTAACAACCTCCCTCCACCTGG - Intergenic
970285867 4:14513987-14514009 CTTAAGAACCTGCTACGTGCTGG + Intergenic
971041154 4:22753705-22753727 CTTATGATCCTTCCTCCACCTGG + Intergenic
984839733 4:184057109-184057131 CTTAAGCACCTGCCTCACACAGG - Intergenic
986456818 5:7927943-7927965 CTTCAGCACCTGCCTCTAGATGG + Intergenic
997675471 5:135709386-135709408 GTTAAGAACTGGCCTCCAACAGG - Intergenic
998158697 5:139800808-139800830 CTTGAGAACATCACTCCAGCAGG + Intronic
998258987 5:140613612-140613634 CTCAAGAACATTGCTCCAGCAGG + Intergenic
1003956330 6:11168796-11168818 CTTATGACCGTGCCTCCACCTGG - Intergenic
1006272602 6:32975652-32975674 CTTAAAAACCTGACTCTAGATGG + Intronic
1014783044 6:125586865-125586887 ATTAAGAGCCTGGTTCCAGCAGG - Intergenic
1017055835 6:150434815-150434837 CTTAAGAACCTCTCTCTGGCTGG + Intergenic
1019726466 7:2605695-2605717 ATTCAGAACCTGCCACCAGGAGG + Intronic
1023047802 7:36226430-36226452 CTTAAGACCCTGCAGCCAGTAGG + Intronic
1031509061 7:122625932-122625954 CTGGAGAACCTGACTACAGCAGG + Intronic
1031828596 7:126598305-126598327 CCTAGAAACCTGCCTCCAACTGG + Intronic
1035535711 8:389597-389619 CTTAGGAAGCTGTCTCCATCGGG + Intergenic
1036612339 8:10361104-10361126 GTTAAGTTCCTGCCTTCAGCAGG + Intronic
1036968343 8:13326514-13326536 CTTAATAAGCTGGCTCCAGTTGG - Intronic
1038200859 8:25411344-25411366 CCTGAGAACTGGCCTCCAGCCGG + Exonic
1038733127 8:30145323-30145345 CTTAAGAACCTGCCTCCAGCTGG - Intronic
1038745668 8:30252795-30252817 CTGAAGAAGCTGCATTCAGCTGG + Intergenic
1039880207 8:41620995-41621017 CTCCTGAGCCTGCCTCCAGCTGG + Exonic
1040081371 8:43289360-43289382 CTAAGGGACCTGACTCCAGCAGG + Intergenic
1042751518 8:72162884-72162906 CTTGAGCACAAGCCTCCAGCAGG + Intergenic
1042764059 8:72301414-72301436 CTTGAGCACAAGCCTCCAGCAGG + Intergenic
1049014916 8:139913573-139913595 CTGCAGACCCTGCCTCCAACAGG + Intronic
1055035201 9:71811090-71811112 TTTAAGAACTTGCATACAGCTGG + Intronic
1060633024 9:125176872-125176894 CTTAACACCCTGTATCCAGCTGG - Intronic
1061760053 9:132844595-132844617 CTTGAAATCCTGTCTCCAGCGGG + Intronic
1187515907 X:19969711-19969733 CCCAAGAACCTGCCTGTAGCAGG + Intronic
1191832709 X:65432138-65432160 CTTTAGAACCTGTTTGCAGCTGG + Intronic
1194724053 X:97373896-97373918 CTTAAGTACCTCCCTCAGGCCGG - Intronic
1197936755 X:131747505-131747527 CTAAACCACCTGCCTCCATCAGG + Intergenic
1199305184 X:146259077-146259099 CTTAAAAATCTTCCACCAGCAGG - Intergenic