ID: 1038740867

View in Genome Browser
Species Human (GRCh38)
Location 8:30215511-30215533
Sequence TTCTAGTAGAATATCCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038740863_1038740867 -2 Left 1038740863 8:30215490-30215512 CCTTGGGCAAGGCTCCCCTAATT No data
Right 1038740867 8:30215511-30215533 TTCTAGTAGAATATCCTTGTAGG No data
1038740859_1038740867 15 Left 1038740859 8:30215473-30215495 CCAAGAGCTAGGAGACACCTTGG No data
Right 1038740867 8:30215511-30215533 TTCTAGTAGAATATCCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038740867 Original CRISPR TTCTAGTAGAATATCCTTGT AGG Intergenic
No off target data available for this crispr