ID: 1038741319

View in Genome Browser
Species Human (GRCh38)
Location 8:30219480-30219502
Sequence CTGTGGCCTTAGAGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038741313_1038741319 0 Left 1038741313 8:30219457-30219479 CCTTGCAAACTAAATACAATGGG No data
Right 1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG No data
1038741311_1038741319 1 Left 1038741311 8:30219456-30219478 CCCTTGCAAACTAAATACAATGG No data
Right 1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG No data
1038741310_1038741319 26 Left 1038741310 8:30219431-30219453 CCTTTGTGATATTTCATTTTGGC No data
Right 1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG No data
1038741308_1038741319 27 Left 1038741308 8:30219430-30219452 CCCTTTGTGATATTTCATTTTGG No data
Right 1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG No data
1038741307_1038741319 28 Left 1038741307 8:30219429-30219451 CCCCTTTGTGATATTTCATTTTG No data
Right 1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038741319 Original CRISPR CTGTGGCCTTAGAGGGACCT GGG Intergenic
No off target data available for this crispr