ID: 1038747954

View in Genome Browser
Species Human (GRCh38)
Location 8:30270445-30270467
Sequence GATGAAGGCGAGACCGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038747954_1038747957 0 Left 1038747954 8:30270445-30270467 CCTTCTTCGGTCTCGCCTTCATC No data
Right 1038747957 8:30270468-30270490 CTAAACTGACTTCCCACATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038747954 Original CRISPR GATGAAGGCGAGACCGAAGA AGG (reversed) Intergenic
No off target data available for this crispr