ID: 1038752526

View in Genome Browser
Species Human (GRCh38)
Location 8:30309453-30309475
Sequence ACTGATAAGTAACTATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038752526_1038752529 6 Left 1038752526 8:30309453-30309475 CCTTGCTATAGTTACTTATCAGT No data
Right 1038752529 8:30309482-30309504 AGTTTCTTTGTCAACTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038752526 Original CRISPR ACTGATAAGTAACTATAGCA AGG (reversed) Intergenic
No off target data available for this crispr