ID: 1038760869

View in Genome Browser
Species Human (GRCh38)
Location 8:30383991-30384013
Sequence CTGAAAAAGCCGGCCCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038760863_1038760869 7 Left 1038760863 8:30383961-30383983 CCGCGCTGGAGATGGGTTTGAAG No data
Right 1038760869 8:30383991-30384013 CTGAAAAAGCCGGCCCGGAGTGG No data
1038760858_1038760869 25 Left 1038760858 8:30383943-30383965 CCGGGCGCGTCGCAGGACCCGCG No data
Right 1038760869 8:30383991-30384013 CTGAAAAAGCCGGCCCGGAGTGG No data
1038760862_1038760869 8 Left 1038760862 8:30383960-30383982 CCCGCGCTGGAGATGGGTTTGAA No data
Right 1038760869 8:30383991-30384013 CTGAAAAAGCCGGCCCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038760869 Original CRISPR CTGAAAAAGCCGGCCCGGAG TGG Intergenic
No off target data available for this crispr