ID: 1038763173

View in Genome Browser
Species Human (GRCh38)
Location 8:30403629-30403651
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038763173_1038763178 23 Left 1038763173 8:30403629-30403651 CCTAGCTAAATCTGTGTATACAC 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1038763178 8:30403675-30403697 ACTCTTAGAAGTGGAATTTCTGG No data
1038763173_1038763179 24 Left 1038763173 8:30403629-30403651 CCTAGCTAAATCTGTGTATACAC 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1038763179 8:30403676-30403698 CTCTTAGAAGTGGAATTTCTGGG No data
1038763173_1038763177 14 Left 1038763173 8:30403629-30403651 CCTAGCTAAATCTGTGTATACAC 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1038763177 8:30403666-30403688 TTAGCTTCAACTCTTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038763173 Original CRISPR GTGTATACACAGATTTAGCT AGG (reversed) Intronic
907171632 1:52471410-52471432 GTGTAAACACAATTTTATCTGGG - Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
911569045 1:99500294-99500316 ATATATACACACAATTAGCTGGG - Intergenic
912068981 1:105783396-105783418 TTGTATACACATCTTTAGTTTGG + Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
917862995 1:179165954-179165976 GTGAATACAAAAAATTAGCTGGG - Intronic
918907660 1:190519099-190519121 GTGTATACACACATTATCCTAGG - Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
924009470 1:239648981-239649003 GTATATACACACATATAGATGGG - Intronic
1062993186 10:1839577-1839599 ATAGATACACAGATTTAGATTGG + Intergenic
1065415440 10:25480455-25480477 ATGAATACAGAGTTTTAGCTTGG - Intronic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1067916538 10:50406008-50406030 GTGTATATATATATTTAGGTGGG - Intronic
1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG + Intergenic
1068207050 10:53868974-53868996 GTGTCTACAAAGAATTAGCCAGG - Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1069180729 10:65355137-65355159 GTATATACACAGAGTTGACTTGG - Intergenic
1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG + Intronic
1070880937 10:79851526-79851548 ATGTAGACACAGATTTACATTGG + Intergenic
1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG + Intergenic
1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG + Intronic
1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG + Intronic
1073152715 10:101322792-101322814 TTATATAGACAGAATTAGCTCGG - Intergenic
1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG + Intergenic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1077915967 11:6611867-6611889 GGGTATAGACAGACCTAGCTGGG - Intronic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1082021195 11:47534855-47534877 GTGACAACACACATTTAGCTGGG - Intronic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG + Intergenic
1082902638 11:58272171-58272193 GTGGAGACACAGTTTTAGTTTGG - Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1089082150 11:115785456-115785478 GTGTACACACAAATACAGCTGGG - Intergenic
1089600070 11:119608562-119608584 GTGTGTGCACAGGTTTAGCTGGG - Intergenic
1092510418 12:9149655-9149677 GTGACTAGACAGATTTAGCATGG - Intronic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1093878942 12:24382134-24382156 GTATATACACACATTAAGTTAGG + Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1107370360 13:39739244-39739266 TTGTAAAAACTGATTTAGCTTGG - Intronic
1107820224 13:44279109-44279131 GTTTATACCCAGATTTATGTTGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1116888755 14:50246601-50246623 GTTTCTACACAAAGTTAGCTGGG - Exonic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1118928998 14:70222506-70222528 CTATATAGACAGCTTTAGCTAGG + Intergenic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1125293222 15:38172914-38172936 GTGTCTACCCAGATTAAGGTTGG - Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126555398 15:49982327-49982349 GTCTATACACAGCAGTAGCTAGG - Intronic
1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG + Intronic
1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG + Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG + Intergenic
1144748605 17:17633089-17633111 GTGTTTACAAACCTTTAGCTAGG + Intergenic
1146366503 17:32233057-32233079 TTGTTAACACAGATTTTGCTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG + Intergenic
1159287349 18:66371872-66371894 GTGCCTACCCAGATTAAGCTGGG - Intergenic
1162560031 19:11411781-11411803 GTGTCTACAAATAATTAGCTGGG - Intronic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1164009434 19:21186630-21186652 GTATATACAGAGAATTTGCTTGG - Exonic
930585763 2:53264958-53264980 TTCTATACTCAGATTTAACTAGG + Intergenic
931174743 2:59842393-59842415 GTGGATAAACAGATCTAGCCTGG - Intergenic
937561808 2:123233483-123233505 GAGTATACACAGTTATAACTGGG - Intergenic
940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG + Intergenic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
945137008 2:206640164-206640186 ATACATACACAGAATTAGCTTGG - Intergenic
947192319 2:227519948-227519970 GTCTGTAAACAGATTTGGCTAGG + Exonic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1171127912 20:22620635-22620657 GTATTTACTCACATTTAGCTCGG + Intergenic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
954598563 3:51850033-51850055 GTGTTTACAAACCTTTAGCTAGG - Intergenic
954662419 3:52233156-52233178 GGGTATACACAGGTCTAGCCTGG + Intronic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
956226154 3:66961468-66961490 ATGTATACACAGACTTAAATTGG - Intergenic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
963348656 3:144126387-144126409 GTGGATACCCAGATTTCACTGGG + Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979783202 4:124682036-124682058 GTGCATACACAGCATTTGCTAGG - Intronic
983571897 4:169217715-169217737 ATGGATACAGAGTTTTAGCTGGG + Intronic
984191278 4:176608705-176608727 GTGTAGACACAGTCTTAGCAAGG + Intergenic
986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG + Intergenic
992695811 5:79285791-79285813 GTACATTCACAGATTTATCTTGG + Intronic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
996066287 5:119083169-119083191 GTGTATATACAAAATTAGCCAGG - Intronic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
1002703189 5:181141880-181141902 GAGTATACACAGTTTCAGTTAGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006391118 6:33759400-33759422 GTGTATACAAAAAATTAGCCAGG - Intergenic
1008042817 6:46819765-46819787 CTGTCCACACAGATTTGGCTTGG - Intronic
1009690955 6:67031347-67031369 GTGTTTACAAAGCTTTAGCTAGG - Intergenic
1010140831 6:72612828-72612850 ATGTATAACAAGATTTAGCTTGG - Intergenic
1012020632 6:93914175-93914197 GTGAATAAACAGCTTTAGCGAGG + Intergenic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1012783683 6:103595725-103595747 GGGTATAGACAGATATAGGTAGG + Intergenic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1013471165 6:110467645-110467667 GTGTATCCAAAAATTTAGCCTGG + Intronic
1014307668 6:119762507-119762529 GTGAATACACTGATTCATCTGGG - Intergenic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1014670261 6:124295034-124295056 GTGTACACAAAGATTTCCCTTGG + Intronic
1017320345 6:153084671-153084693 GTGGACAGACAGCTTTAGCTAGG + Intronic
1019508915 7:1407511-1407533 TTAAATACACAGATTTAGCCAGG - Intergenic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1024186539 7:46953883-46953905 GCATATAGACAGATATAGCTTGG + Intergenic
1025703528 7:63842174-63842196 GTGTATACACACATATATTTTGG - Intergenic
1034503165 7:151464825-151464847 GTGTACACACAGGATTAGCACGG + Intergenic
1038244516 8:25842917-25842939 GTCTATACACAGACTTAGTTTGG - Exonic
1038255992 8:25951617-25951639 GAGAATACACACACTTAGCTAGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1042238083 8:66635750-66635772 GAGAATACACAAAATTAGCTGGG + Intronic
1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG + Intronic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1043722206 8:83558843-83558865 GTGTATGCTCAGAAATAGCTAGG - Intergenic
1046085486 8:109428825-109428847 TTGTATATACTGATTTAACTTGG + Intronic
1046310362 8:112428268-112428290 TTGTATACTCTGTTTTAGCTTGG - Intronic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1047752696 8:127893838-127893860 GTGTATACGAGGATGTAGCTGGG + Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1051863684 9:21654532-21654554 GTGTATAGATAGATTTATTTTGG + Intergenic
1051934839 9:22434147-22434169 GTGTTTACAAACTTTTAGCTAGG - Intergenic
1052327674 9:27233020-27233042 AGGTATACACAGAGTTAGCATGG - Intergenic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1057353297 9:94317532-94317554 ATGTAGACACAGATTTACATTGG - Intergenic
1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG + Intronic
1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG + Intronic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1188346792 X:29077216-29077238 GGGAGTACACAGATTTGGCTGGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1190388696 X:49910678-49910700 GTACACACACAGATTTAGGTAGG - Intergenic
1190878897 X:54478829-54478851 GTGTATATACAGTTTTACGTTGG - Intronic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG + Intronic
1195304351 X:103564901-103564923 GTATGTACACAGGTTTAACTAGG - Intergenic
1198524441 X:137486453-137486475 GTAGATACACAGATTTATTTCGG - Intergenic
1200750357 Y:6939326-6939348 GTGTTTACAAACCTTTAGCTAGG + Intronic