ID: 1038763177

View in Genome Browser
Species Human (GRCh38)
Location 8:30403666-30403688
Sequence TTAGCTTCAACTCTTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038763173_1038763177 14 Left 1038763173 8:30403629-30403651 CCTAGCTAAATCTGTGTATACAC 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1038763177 8:30403666-30403688 TTAGCTTCAACTCTTAGAAGTGG No data
1038763175_1038763177 -9 Left 1038763175 8:30403652-30403674 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1038763177 8:30403666-30403688 TTAGCTTCAACTCTTAGAAGTGG No data
1038763174_1038763177 -8 Left 1038763174 8:30403651-30403673 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1038763177 8:30403666-30403688 TTAGCTTCAACTCTTAGAAGTGG No data
1038763172_1038763177 17 Left 1038763172 8:30403626-30403648 CCTCCTAGCTAAATCTGTGTATA 0: 2
1: 0
2: 0
3: 12
4: 134
Right 1038763177 8:30403666-30403688 TTAGCTTCAACTCTTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038763177 Original CRISPR TTAGCTTCAACTCTTAGAAG TGG Intronic
No off target data available for this crispr