ID: 1038765091

View in Genome Browser
Species Human (GRCh38)
Location 8:30420374-30420396
Sequence AAGCTAATCTATAAGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038765090_1038765091 2 Left 1038765090 8:30420349-30420371 CCAAGTACTTTAAACAGAATTTG 0: 1
1: 0
2: 0
3: 27
4: 314
Right 1038765091 8:30420374-30420396 AAGCTAATCTATAAGTCAGCTGG No data
1038765089_1038765091 3 Left 1038765089 8:30420348-30420370 CCCAAGTACTTTAAACAGAATTT 0: 1
1: 1
2: 6
3: 46
4: 539
Right 1038765091 8:30420374-30420396 AAGCTAATCTATAAGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038765091 Original CRISPR AAGCTAATCTATAAGTCAGC TGG Intronic
No off target data available for this crispr