ID: 1038765394

View in Genome Browser
Species Human (GRCh38)
Location 8:30423369-30423391
Sequence TGCATACACAAAGAGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 354}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038765394_1038765403 7 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765403 8:30423399-30423421 GTTGCCTAGCTACCTCGGAGGGG No data
1038765394_1038765401 5 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765401 8:30423397-30423419 TGGTTGCCTAGCTACCTCGGAGG No data
1038765394_1038765399 2 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765399 8:30423394-30423416 GCCTGGTTGCCTAGCTACCTCGG No data
1038765394_1038765406 17 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765406 8:30423409-30423431 TACCTCGGAGGGGACAGTGAGGG No data
1038765394_1038765409 22 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765409 8:30423414-30423436 CGGAGGGGACAGTGAGGGCTGGG No data
1038765394_1038765405 16 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data
1038765394_1038765408 21 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765408 8:30423413-30423435 TCGGAGGGGACAGTGAGGGCTGG No data
1038765394_1038765402 6 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765402 8:30423398-30423420 GGTTGCCTAGCTACCTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038765394 Original CRISPR TGCATACACAAAGAGGAAAG AGG (reversed) Intronic
900075242 1:810097-810119 TGCATCCAAAAAAAGGAAAAAGG - Intergenic
903050126 1:20594444-20594466 TGAGGACACAAAGAGGAGAGTGG + Intronic
903210150 1:21813518-21813540 TGTAAGCACAGAGAGGAAAGAGG - Intronic
903751258 1:25622356-25622378 TCCATAAACAAACAGTAAAGAGG - Intronic
905430960 1:37923060-37923082 AGCATGCTCAAAGAGGAAGGGGG + Intronic
905458348 1:38104039-38104061 TGGACACCCAAAGAGGGAAGAGG - Intergenic
905515604 1:38559715-38559737 TTCATACACGAAGAAGGAAGTGG - Intergenic
906821290 1:48933004-48933026 TGCATAAACAAAGAGGTAAAAGG - Intronic
908535105 1:65068991-65069013 TGGATGCACAAAGGGGAGAGTGG - Intergenic
910128952 1:83880559-83880581 TGAATAAACAATGAGGAAAATGG - Intronic
910354446 1:86339868-86339890 TGCATGCACAGAGAGGCAACTGG - Intergenic
912125597 1:106533463-106533485 TTCATACACAAAGTGCAAAGTGG - Intergenic
914426323 1:147580407-147580429 TCTACCCACAAAGAGGAAAGTGG - Intronic
914814074 1:151050298-151050320 TGCATACAAAAATAAGTAAGGGG + Intronic
915190564 1:154147098-154147120 AGCATATACAAAGGGGAAAATGG + Intronic
916123906 1:161552230-161552252 TGTATGCACAAAGAAGACAGTGG + Intergenic
916133790 1:161633592-161633614 TGTATGCACAAAGAAGACAGTGG + Intronic
916203587 1:162294633-162294655 TTCATAAACAAAGAGAAGAGGGG + Intronic
917604248 1:176610098-176610120 TTTATACTCAAATAGGAAAGAGG - Intronic
917920715 1:179747375-179747397 TGGATACACAAAGGGGATGGGGG + Intronic
918161554 1:181905548-181905570 TGCATACAAAAAGAAGCAGGAGG - Intergenic
918414474 1:184292299-184292321 GGCATGCGCAATGAGGAAAGTGG - Intergenic
918880223 1:190109999-190110021 TACATACACACATATGAAAGGGG - Intronic
919032396 1:192259881-192259903 TACAAACACATAGAGGAAAGGGG + Intergenic
920293501 1:204941063-204941085 TGTATATACAAAGAGAAAAATGG + Intronic
921619156 1:217307660-217307682 TGCATACGCTAAGATGCAAGAGG + Intergenic
922044586 1:221931939-221931961 TGCAGACATAAAAAGGAATGAGG + Intergenic
923533573 1:234830797-234830819 TGCAGACACAGAGACGAACGTGG + Intergenic
924026584 1:239839705-239839727 TTTATACAGAAAGAAGAAAGGGG + Intronic
924190037 1:241541112-241541134 TGCATACAGACTGGGGAAAGAGG + Intronic
1063340806 10:5261717-5261739 TGCAGACACAGGGAGAAAAGGGG + Intergenic
1064595684 10:16942747-16942769 AGCATGAACAAACAGGAAAGGGG + Intronic
1064760623 10:18616429-18616451 GGCATACATATAGAGGAAACAGG + Intronic
1065559799 10:26951057-26951079 TGAATAACCAAAGAGGGAAGTGG - Intergenic
1065884201 10:30062509-30062531 AGAATTAACAAAGAGGAAAGAGG + Intronic
1066221705 10:33341412-33341434 TGCATTCACAAAGTTCAAAGTGG + Intergenic
1068820062 10:61365057-61365079 TGCAGATGCAAAGAGTAAAGGGG + Intergenic
1068982218 10:63073491-63073513 TGCATACATAAAGCAGAAAACGG - Intergenic
1069176869 10:65301330-65301352 AGCAAACAGAAAGAGGAATGAGG + Intergenic
1069896685 10:71684441-71684463 TGGAGACACCAAGTGGAAAGAGG + Intronic
1070115282 10:73522799-73522821 TGTATATAAAAAGAGAAAAGTGG + Intronic
1070641649 10:78174613-78174635 AACATACACAAAGAGACAAGAGG - Intergenic
1071182238 10:83000222-83000244 TACACACACACAGAGGAGAGAGG + Intergenic
1071192474 10:83117775-83117797 TGCTTATATACAGAGGAAAGGGG + Intergenic
1071895856 10:90065866-90065888 TGCATTTTAAAAGAGGAAAGTGG - Intergenic
1072316397 10:94207392-94207414 TACAAACACAAAAAGGAAAAAGG + Intronic
1072873126 10:99142040-99142062 TGCGAACACAATGAGGAAACTGG - Intronic
1074200292 10:111228574-111228596 TGCAGAGACAAAGATGAGAGAGG + Intergenic
1074305136 10:112270132-112270154 TAAAAACACAAAGGGGAAAGAGG + Intergenic
1075215332 10:120527938-120527960 TGCATAAAGAAAGAGGAAACAGG + Intronic
1076623019 10:131804961-131804983 TGCAGTCACAGAGAGGAGAGAGG - Intergenic
1078376053 11:10794188-10794210 TGGAGATACAAAAAGGAAAGAGG + Intergenic
1080142499 11:28939621-28939643 TGGATACACAAAGAAGATAATGG - Intergenic
1080413346 11:32046839-32046861 AGCAAACACAAAGGGGAAAGAGG - Intronic
1081737777 11:45416220-45416242 TGCATAAATATACAGGAAAGAGG - Intergenic
1082684931 11:56225796-56225818 TGCATAAACACAGAGGAGAATGG - Intergenic
1083060251 11:59862428-59862450 TGCATACTGAAAGAGAAAAAGGG + Intronic
1083816643 11:65136122-65136144 TGCATAGCCAGAGAGAAAAGAGG - Intergenic
1084610722 11:70201225-70201247 TGCATCCATAAAAAGGAAGGAGG + Intergenic
1084856652 11:71993161-71993183 TGTCTACACAAATAGGTAAGAGG - Intronic
1085334672 11:75682494-75682516 TGCAGCCATAAAAAGGAAAGAGG - Intergenic
1085340594 11:75728766-75728788 TGGAGACAAATAGAGGAAAGAGG - Intronic
1086185928 11:84015713-84015735 TGCAGCCATAAAGAGGAACGAGG - Intronic
1086428895 11:86716315-86716337 TGTTTATACAAAGAGGGAAGAGG + Intergenic
1086452431 11:86930468-86930490 TAAATAAGCAAAGAGGAAAGTGG + Intronic
1086584279 11:88433483-88433505 TGCATACACAGAGAGCAAAGCGG + Intergenic
1087301514 11:96441588-96441610 TGCATAACCAAAGAGAAAATTGG + Intronic
1087398057 11:97627746-97627768 TACCTACTCAAATAGGAAAGGGG + Intergenic
1089997706 11:122924678-122924700 TGCAGACACGAAGAGAAAACTGG - Intronic
1090342579 11:126037966-126037988 TGACTGCACTAAGAGGAAAGGGG + Intronic
1091200858 11:133779813-133779835 TGCAGAGACAAAGAGGAAAGAGG - Intergenic
1092720084 12:11432871-11432893 TGTATACAGAAAGAGAGAAGGGG - Intronic
1092743673 12:11653643-11653665 CGCAGACAGAAAGAGGAAAGGGG - Intronic
1092932165 12:13326342-13326364 TGCAGAGAAAAAGAGGAAAGAGG + Intergenic
1093549026 12:20384859-20384881 TGCAGCCATAAAGAGGAATGAGG - Intronic
1093637226 12:21485713-21485735 TAAATAAACTAAGAGGAAAGGGG + Intronic
1093919219 12:24840728-24840750 TGGCTACAAAAAGAGGAAAATGG - Intronic
1095601353 12:44016459-44016481 TGAAGAAAGAAAGAGGAAAGGGG - Intronic
1095881913 12:47146905-47146927 TGCATACAGTAAGATGCAAGAGG - Intronic
1096935747 12:55272839-55272861 TGAATAAACAAAAAGGAAATAGG + Intergenic
1097715762 12:62964157-62964179 TGCATAAAGAAAGAGAAAATTGG - Intergenic
1097986707 12:65790489-65790511 TGCAAACTCATAGAGGAAATTGG - Intergenic
1098392279 12:69982015-69982037 TGCATAAACAGAGAAGAAGGAGG + Intergenic
1098631781 12:72731911-72731933 TCCATACTCAGAGAGGAAAAAGG + Intergenic
1098656833 12:73041852-73041874 TGAATAAACCAAGAAGAAAGGGG - Intergenic
1099248804 12:80226778-80226800 TGACTAAACAAAGAGGAAATGGG - Intronic
1099711317 12:86228691-86228713 TACATACATAAAGAGAAAACAGG - Intronic
1100001680 12:89844313-89844335 AGCAAGCACAAAGAGAAAAGAGG - Intergenic
1100964634 12:99999163-99999185 TCCATATAAAAAGAGGAAATTGG - Intergenic
1102068451 12:109998391-109998413 TGCATACACTCAGAGGGCAGAGG + Intergenic
1102148284 12:110670889-110670911 TCCTTACAAAAAGAGAAAAGGGG + Intronic
1103480351 12:121246620-121246642 TGCTCAGACACAGAGGAAAGAGG - Intronic
1104448477 12:128851931-128851953 TACATAAGCAAACAGGAAAGGGG - Intergenic
1104540075 12:129655841-129655863 TGCAAACACACAGAAGGAAGGGG + Intronic
1104604183 12:130175934-130175956 TGGATACCCAAAGAGAAAAGGGG - Intergenic
1104866237 12:131956596-131956618 TGCATACAGCAGTAGGAAAGTGG - Intronic
1105256880 13:18749659-18749681 AGAAGACACAGAGAGGAAAGAGG + Intergenic
1105259565 13:18769033-18769055 AGAAGACACAGAGAGGAAAGAGG + Intergenic
1105685348 13:22775646-22775668 TGCATACATCCAGATGAAAGTGG + Intergenic
1105782614 13:23717180-23717202 TACATACACAAAATGGGAAGGGG + Intergenic
1105934893 13:25089746-25089768 TTCATACACAAAGAGGGAAAAGG - Intergenic
1106627989 13:31440858-31440880 TGCATACACAGAGAGTACAAAGG - Intergenic
1106632049 13:31484702-31484724 TACATACACAAAGAACAGAGTGG - Intergenic
1106954690 13:34923674-34923696 TGCAGAGCCAAAGATGAAAGGGG + Intergenic
1107034901 13:35891808-35891830 AGAATAAACAAAGAGGGAAGGGG - Intronic
1107303094 13:38986684-38986706 TGCATAGAGAAAAAGGAAGGAGG - Intronic
1109225605 13:59690942-59690964 TGCAGAAGCAAAGAGGACAGAGG + Intronic
1109368926 13:61396386-61396408 TGAATAAACAAATAGTAAAGTGG - Intergenic
1109711808 13:66171122-66171144 TGCATAAAGAAAAAAGAAAGAGG + Intergenic
1109914733 13:68967747-68967769 TGCAGACACTAAGAAGAAGGAGG - Intergenic
1110009404 13:70313103-70313125 TGGAAACACAAAGATGAAAAAGG - Intergenic
1110092104 13:71465477-71465499 TGAATACAAAAAGAGGAAGCAGG + Intronic
1110588787 13:77228832-77228854 TGTATACACAGAGAAAAAAGAGG + Intronic
1111443922 13:88320194-88320216 TGCATATATAAGGAGGAAATGGG + Intergenic
1111881405 13:93961439-93961461 TGAATATAAAAAGAGGAAGGTGG - Intronic
1112274947 13:98008430-98008452 TGCAAGCACACAGAGGAAACCGG - Intronic
1112961105 13:105127486-105127508 TGCATATAGATATAGGAAAGAGG + Intergenic
1113835692 13:113326953-113326975 TGGTTACACAGAGAGGTAAGCGG + Intronic
1114071706 14:19115205-19115227 TGCAGAGCCAAAGATGAAAGGGG + Intergenic
1114090555 14:19284759-19284781 TGCAGAGCCAAAGATGAAAGGGG - Intergenic
1116303368 14:43216336-43216358 TGCATAATCATAGAAGAAAGTGG - Intergenic
1117084573 14:52186119-52186141 TGCATACAGGGAGGGGAAAGTGG - Intergenic
1118941671 14:70345146-70345168 TGCATGCACAGAGAGGCAACTGG - Intronic
1119012393 14:71007568-71007590 TGGATTAACAAAGAGCAAAGAGG - Intronic
1119764156 14:77177996-77178018 AGTCTTCACAAAGAGGAAAGAGG + Intronic
1120464988 14:84845117-84845139 TGCATGCTCAGAGAGGAAAGAGG - Intergenic
1120962894 14:90141198-90141220 TGCAAACACACACAAGAAAGTGG + Intronic
1121274769 14:92659983-92660005 TTCTTACAAAAAGAGGAAATTGG - Intronic
1121345758 14:93134744-93134766 TGCAGAGTCAGAGAGGAAAGAGG + Intergenic
1121986242 14:98508949-98508971 TTCAAAAACAAAGAGGGAAGAGG - Intergenic
1122320553 14:100852750-100852772 TGCATGCACCAAGAGGAAATTGG + Intergenic
1202863535 14_GL000225v1_random:100464-100486 TGGATAGACGAAGAGGAAGGGGG + Intergenic
1123828906 15:24113340-24113362 TGTATAAACAAACAGAAAAGGGG - Intergenic
1125352457 15:38782125-38782147 GGCAAACACAAAGAGGATTGAGG + Intergenic
1126362749 15:47863175-47863197 TGCTTAAGCAAAGGGGAAAGGGG - Intergenic
1128964492 15:72044564-72044586 TGCATAGAAACAGAGCAAAGTGG - Intronic
1129077429 15:73009028-73009050 CCCATACACGAAGAGGAAACTGG + Intergenic
1129790528 15:78338016-78338038 TGGATGGACAAAGAGGGAAGAGG - Intergenic
1130375545 15:83325834-83325856 TGCATACAGAGAGGGGGAAGAGG - Intergenic
1131767311 15:95692504-95692526 TGGATACAGAACCAGGAAAGGGG + Intergenic
1131769292 15:95717442-95717464 TGAATACATAAATAAGAAAGAGG - Intergenic
1133472329 16:6087463-6087485 TGTATACACATAGAGAAAAAAGG - Intronic
1133616167 16:7479035-7479057 CGAATCCACAAACAGGAAAGTGG + Intronic
1133830148 16:9315515-9315537 CCCAAACACAAAGAGGAAAAAGG - Intergenic
1134170685 16:11966956-11966978 TGCATACAGAAATAGGGCAGTGG - Intronic
1135509811 16:23072581-23072603 TTCTTACACAAAGAGAAGAGAGG + Intronic
1136542848 16:30937965-30937987 TGCTCACAGAAAGAGCAAAGGGG + Intronic
1137659873 16:50195436-50195458 TGAAAACTGAAAGAGGAAAGGGG + Intronic
1138058272 16:53859142-53859164 TGCACATACAAAGGGGAAAATGG - Intronic
1139810555 16:69612958-69612980 TGAATACATAAACAGGAGAGAGG - Intronic
1139895157 16:70282632-70282654 TGCATTGGCAAAGAGCAAAGTGG + Exonic
1140215515 16:73004293-73004315 TGCATACAGATAGAGAAAAATGG - Intronic
1140889307 16:79271509-79271531 TGCATACTTACAGAGGACAGAGG - Intergenic
1141696129 16:85620483-85620505 TGAAGACACAAAGTGGAATGCGG + Intronic
1142618430 17:1150446-1150468 TCCAGACACAAAGAGGAGGGTGG + Intronic
1144195505 17:12890801-12890823 TGCATACAGTAAGATGCAAGAGG - Intronic
1146253892 17:31377602-31377624 TACATACACAAGGAGGAAAATGG - Exonic
1146423648 17:32714398-32714420 TGCAGCCATAAAAAGGAAAGAGG - Intronic
1146672944 17:34754451-34754473 TGACTCCACCAAGAGGAAAGGGG - Intergenic
1147835434 17:43327327-43327349 TTGATCCACAAAAAGGAAAGTGG - Intergenic
1148761906 17:50008118-50008140 TGTATACAGAATGAGAAAAGAGG + Intergenic
1150466383 17:65396346-65396368 TGCATCCATAAAAAGGAAAAAGG + Intergenic
1151809849 17:76432582-76432604 AGCATACTGAAATAGGAAAGGGG + Intronic
1154426460 18:14275768-14275790 AGAAGACACAGAGAGGAAAGAGG - Intergenic
1154431469 18:14311708-14311730 AGAAGACACAGAGAGGAAAGAGG - Intergenic
1154434154 18:14331012-14331034 AGAAGACACAGAGAGGAAAGAGG - Intergenic
1154907546 18:20596488-20596510 TACATATACAAAGTGGACAGCGG - Intergenic
1155466052 18:26136489-26136511 TGCCTACAGAAAGGGGAGAGAGG + Intronic
1156204252 18:34868828-34868850 AAGATACACAAAGAAGAAAGAGG - Intronic
1158788549 18:60745751-60745773 TGCATAAACAAAGCTGAAAAGGG + Intergenic
1159484187 18:69032305-69032327 TATATCCCCAAAGAGGAAAGTGG + Intronic
1160273147 18:77406101-77406123 CTCTTAGACAAAGAGGAAAGAGG - Intergenic
1161267048 19:3369103-3369125 TGCAGAGACAAAGAGGAGAAAGG - Intronic
1161513851 19:4685635-4685657 TCCATATACAAAGAGGACGGTGG + Exonic
1161895111 19:7074308-7074330 TATACACACAAAGATGAAAGCGG - Intronic
1162521067 19:11179802-11179824 TGGCTACACAAAAAGGAAACTGG - Intronic
1162737809 19:12756111-12756133 TGCAAACACACAGGGTAAAGTGG - Intronic
1165256699 19:34580576-34580598 TGGAGACACAGAGGGGAAAGAGG - Intergenic
1166584228 19:43931197-43931219 TCCATAGAAAAAGTGGAAAGTGG + Intronic
1167044407 19:47041239-47041261 TGCAGACACGAAGGGGAAGGAGG + Intronic
925333956 2:3079543-3079565 TGTTCACACAAAGAGGACAGGGG + Intergenic
925472339 2:4175800-4175822 TGCATACACAGAGAGGACAGGGG + Intergenic
925524634 2:4786369-4786391 TGCAGCCACTTAGAGGAAAGAGG - Intergenic
925613738 2:5725621-5725643 TCCATACTAAAAGAGTAAAGTGG + Intergenic
926922657 2:17954417-17954439 TGCAAAGACAAACAGGAGAGAGG + Intronic
927083352 2:19651706-19651728 GGAATCCACAAAGAGGAACGTGG + Intergenic
929262288 2:39879197-39879219 TGCAGCCATAAAAAGGAAAGAGG + Intergenic
929503867 2:42513159-42513181 TGCCAACACAAAGATGAAATGGG - Intronic
930388959 2:50736257-50736279 TGAATTCAGAAAGAGGAATGGGG - Intronic
930517796 2:52430928-52430950 TGAATACATAATGAGGAGAGAGG + Intergenic
931841800 2:66159004-66159026 TGCACAGACAGAGAGGAAAAGGG + Intergenic
932413279 2:71559620-71559642 TGCAAAGACACAGAGGCAAGGGG - Intronic
933932273 2:87165560-87165582 TGAATGCACAAAGAGGGAAGGGG - Intergenic
934072777 2:88400288-88400310 TGGAAAGACAAAGAGGGAAGGGG - Intergenic
935366172 2:102293176-102293198 TGCACAGAGAAAGAGGGAAGAGG + Intergenic
935388614 2:102526621-102526643 GCCATACACAAAGAGGAAGTAGG + Intronic
935730587 2:106062108-106062130 TGAATGCACACAGGGGAAAGGGG - Intergenic
935872555 2:107467135-107467157 TGCATAAGCAGAGAGGAATGTGG - Intergenic
936360840 2:111799875-111799897 TGAATGCACAAAGAGGGAAGGGG + Intronic
936439117 2:112534890-112534912 TGCACAAACAGAGAGGACAGAGG + Exonic
936847219 2:116851765-116851787 TGCCTCCAGAAAGAGGAAAATGG - Intergenic
937520644 2:122709380-122709402 TGGACACACAAACAGGCAAGTGG - Intergenic
937610011 2:123849952-123849974 AGAATACAAAAAGATGAAAGAGG + Intergenic
938166458 2:129031731-129031753 TTAATACACAAAGAAGACAGAGG + Intergenic
938579384 2:132632658-132632680 TGCTTATACAAATAGAAAAGTGG - Intronic
940979753 2:159988035-159988057 AGCATACACAAAGAAAAAAGTGG - Intronic
941673054 2:168315739-168315761 GGTATACACAATGAAGAAAGAGG + Intergenic
941827986 2:169921014-169921036 TGTAGACAGAAAGAAGAAAGTGG + Intronic
942311275 2:174659313-174659335 TTAATACACAAACAGGAAACAGG - Intronic
942794857 2:179805832-179805854 TGGATAGACAAAGAGGACACTGG + Intronic
942838447 2:180330009-180330031 TGAATACACAAAAAAGAAAAAGG + Intergenic
943422470 2:187683982-187684004 TGCATAGACAAAGTGGTACGTGG - Intergenic
944074762 2:195716404-195716426 TACACACACAAAGAAGAAATTGG - Intronic
944767390 2:202878194-202878216 TGCATAGACAAAGAATAAAATGG - Exonic
944786867 2:203080450-203080472 AGCAAAAACAAGGAGGAAAGGGG - Intronic
945749646 2:213765534-213765556 TGCAGACAGAAAAAGGTAAGTGG - Intronic
1169952933 20:11066716-11066738 TCCATACTCAAACAGGAAAATGG - Intergenic
1171135857 20:22693890-22693912 TGCAGCCATAAAGAGGAAAGAGG - Intergenic
1172581422 20:36051413-36051435 TGGAAACATAAAAAGGAAAGAGG + Intergenic
1174569955 20:51494368-51494390 TGTTTAAACAAAGAGGAAATAGG - Intronic
1174691991 20:52515761-52515783 GGCACACACAAAGAGGACTGGGG + Intergenic
1175069745 20:56323370-56323392 TTCAAACACAAAGAGGAACAAGG + Intergenic
1175586905 20:60148447-60148469 TACAAAGACAAAGAGGAAAGGGG + Intergenic
1176848307 21:13893610-13893632 AGAAGACACAGAGAGGAAAGAGG + Intergenic
1178506431 21:33166859-33166881 TGGAGACACACAGAGGGAAGAGG + Intronic
1179102143 21:38363393-38363415 TTGTTACACAAAGAGGAAAAAGG - Intergenic
1179816860 21:43911916-43911938 TACATTCACCAAGAGGTAAGGGG - Intronic
1180245676 21:46545861-46545883 TGCCTGCACAAAGTGGAGAGGGG - Exonic
1180490145 22:15837556-15837578 TGCAGAGCCAAAGATGAAAGGGG + Intergenic
949596687 3:5555100-5555122 TGTATACTCACACAGGAAAGAGG - Intergenic
949829022 3:8194672-8194694 TGCATAAACAAAGAAGCAAAGGG + Intergenic
950267527 3:11585803-11585825 TGCATTCAGAAAGAGGACAAGGG - Intronic
951454773 3:22878330-22878352 TGCATACACAAAAGGGAATGAGG - Intergenic
952749050 3:36809696-36809718 TGCTCACACATGGAGGAAAGGGG + Intergenic
953475760 3:43204676-43204698 TGAATGCAGAAAGAGGACAGTGG - Intergenic
953496164 3:43388728-43388750 TGAATTCACAAAGAGGATAAAGG + Intronic
953534404 3:43766323-43766345 TACATACAGATATAGGAAAGAGG + Intergenic
955539322 3:59957268-59957290 TGGATACACAAAGAGAAACCAGG + Intronic
955775649 3:62430154-62430176 TGCATACAAAAAAAGATAAGGGG - Intronic
956362620 3:68465211-68465233 TCAAGGCACAAAGAGGAAAGAGG - Intronic
956399177 3:68858624-68858646 TGCATTCACATAGATGCAAGTGG + Intronic
957141243 3:76360809-76360831 TGCATCCACACAGGAGAAAGGGG - Intronic
959267274 3:104158272-104158294 CACATACACCAAGAAGAAAGTGG - Intergenic
959977850 3:112481841-112481863 TGCATACAGTAAGAGGCAGGAGG - Intronic
960531842 3:118773918-118773940 TGAATACAGAAAGAAGAAAATGG + Intergenic
960880205 3:122336484-122336506 TGACTACATAAAGAGGAGAGAGG + Intronic
961916921 3:130385690-130385712 TGCATACACAAATAAGTACGGGG + Intronic
962042170 3:131718775-131718797 TGGAGACACAAAGATGAAAAAGG - Intronic
966393508 3:179477301-179477323 TGCATACAGTAAGATGCAAGAGG - Intergenic
969255985 4:6002191-6002213 AACAGACACACAGAGGAAAGAGG + Intergenic
970759147 4:19462512-19462534 TGCATGAACAAAAAGGAATGAGG - Intergenic
970985783 4:22156012-22156034 TGTATACACACATAGGAAACAGG + Intergenic
972207376 4:36792228-36792250 TGCAGACATAAAAAGGAAGGAGG - Intergenic
972789896 4:42361477-42361499 TACTTACAGCAAGAGGAAAGAGG + Intergenic
972929686 4:44056656-44056678 TGAAGACACTAACAGGAAAGAGG + Intergenic
973719431 4:53708193-53708215 TGCATGCATCTAGAGGAAAGGGG + Intronic
973846746 4:54920632-54920654 TTCATGAACAAAGAGGAGAGGGG - Intergenic
975114557 4:70664681-70664703 TGGATACACAAGTAGGAAAGAGG - Intronic
975276970 4:72513670-72513692 AGCATACAGAGACAGGAAAGAGG - Intronic
975912187 4:79279998-79280020 TGTGCACCCAAAGAGGAAAGTGG - Intronic
978582608 4:110247355-110247377 TGTAGACACAGAGAGGAAAGGGG - Intergenic
979103286 4:116650738-116650760 TGAATACAAAAAGAAAAAAGAGG + Intergenic
981105548 4:140876521-140876543 TGCATACCCTCTGAGGAAAGCGG - Intronic
981720058 4:147792576-147792598 AGCATATATAAAGAGGGAAGAGG - Intronic
981798813 4:148631975-148631997 TGCAGACAGAGAGAGAAAAGGGG - Intergenic
982662490 4:158223740-158223762 TGCAGCCATAAAGAGGAATGAGG - Intronic
982682466 4:158447889-158447911 TGCATACATACAGAAGAAAGAGG + Intronic
984641093 4:182164937-182164959 TGAAGACACAAAGAGTAGAGAGG - Intronic
984934482 4:184878391-184878413 TGAATACAGTAAGAAGAAAGAGG + Intergenic
986145443 5:5073117-5073139 TGCATCCACCAGGAGGAAAGGGG - Intergenic
986260816 5:6144821-6144843 TGCATAAAGAAAGAGGTAAGAGG + Intergenic
986319555 5:6617655-6617677 TGCATACATCAAGAGGTAAACGG + Intronic
986494018 5:8323480-8323502 CTCTTACACAAAGAGGAGAGGGG - Intergenic
987721422 5:21638006-21638028 TGTACAGAGAAAGAGGAAAGTGG + Intergenic
989586141 5:43075135-43075157 TGCATGCACAGAGAGGCAACTGG + Intronic
990464075 5:56055937-56055959 TGGATACACATAGAGAACAGGGG - Intergenic
991344079 5:65644443-65644465 TGAAAAGGCAAAGAGGAAAGGGG - Intronic
992604934 5:78446173-78446195 TACATACAGAAAGAGGAAGGTGG + Intronic
993021437 5:82596320-82596342 TGCATAATCAGAGAGTAAAGGGG + Intergenic
993199293 5:84792107-84792129 TTCACACACAAAGATGAAACTGG - Intergenic
993358650 5:86946107-86946129 TGCACACACAAAGTGAAAACAGG + Intergenic
993625155 5:90215083-90215105 TGCAGACAGTGAGAGGAAAGGGG + Intergenic
995751315 5:115455990-115456012 TGAATACACAGAGAGGAAAGGGG - Intergenic
995840389 5:116438355-116438377 AGCAAACACAAAGAGAACAGTGG + Intergenic
995943854 5:117618357-117618379 TGCATTCAGAAAGGGGAAATGGG + Intergenic
996117464 5:119634100-119634122 TGTGTAAACAAAGAGGAAAGGGG + Exonic
997114347 5:131110011-131110033 TGCACACACAAAGTGGTCAGAGG + Intergenic
998069283 5:139184139-139184161 TTCAAACCAAAAGAGGAAAGAGG + Intronic
998304900 5:141065274-141065296 AGCGAACTCAAAGAGGAAAGCGG + Intergenic
998609765 5:143675181-143675203 TGAATACAGAATGAGGAAACTGG - Intergenic
998899582 5:146838641-146838663 AGCATACAAAAAGAGGAATGAGG + Intronic
999021700 5:148173124-148173146 TGAATAAAAAAAGAGGGAAGAGG + Intronic
999450466 5:151673956-151673978 CACACACACACAGAGGAAAGGGG - Intronic
999473361 5:151875801-151875823 AGCATAAAGAAAGAGGGAAGTGG - Intronic
999981398 5:156961095-156961117 TGCACATACAAAGAGCCAAGAGG + Intronic
1000724620 5:164753920-164753942 TGCATAAACAAGGAGGAGACTGG - Intergenic
1001421957 5:171594344-171594366 TGCATCCATAGAGAGGAAAGTGG + Intergenic
1001888679 5:175319893-175319915 AGTCTTCACAAAGAGGAAAGGGG + Intergenic
1003081675 6:3026362-3026384 TGTATACACAAAGAAGGAGGAGG + Intergenic
1003724880 6:8749848-8749870 TGAATGCATAAAGAAGAAAGTGG + Intergenic
1003858123 6:10296419-10296441 AGCATACACAAAGCAGAAAGTGG + Intergenic
1005099334 6:22153144-22153166 TGTTTACAAAAAGAGGCAAGGGG + Intergenic
1005444865 6:25911960-25911982 TGACAACACAAAGAGGAAAGGGG - Intergenic
1006337842 6:33429898-33429920 AGCAGAAACACAGAGGAAAGGGG - Intronic
1006578219 6:35061273-35061295 TGTATCCACAGAGAAGAAAGAGG - Intronic
1007526736 6:42502519-42502541 TGCATGCACAAAGTAGAAAGTGG + Intergenic
1008440647 6:51528396-51528418 GTCATACATAAAGAGGAGAGTGG - Intergenic
1008558516 6:52699849-52699871 TGCAAAAACAAAGAGCAGAGGGG - Intergenic
1008738302 6:54574120-54574142 TGGATTCACAAAGAGGATTGTGG + Intergenic
1009328181 6:62380354-62380376 TCAAGACACAAAGGGGAAAGAGG + Intergenic
1009441208 6:63680932-63680954 TGAATCCAGAAAGAGGAAATAGG - Intronic
1012102405 6:95106131-95106153 TGCAGAAAGAGAGAGGAAAGAGG + Intergenic
1012372682 6:98526612-98526634 TGTATTCACAAAGAGTAAACAGG + Intergenic
1012980797 6:105828765-105828787 TTCAGACACAAAGAGGAGAATGG + Intergenic
1013887812 6:114991095-114991117 TGCTTAGACACAGAAGAAAGTGG + Intergenic
1014829672 6:126087806-126087828 TGCAGAAACAGAGAGAAAAGAGG - Intergenic
1017749709 6:157479943-157479965 TCCTCACACAAAGAGGAAAAAGG + Intronic
1018078415 6:160237359-160237381 TTCCTACACAAAGAGTAAAACGG - Intronic
1018591176 6:165424113-165424135 TACACAGGCAAAGAGGAAAGAGG - Intronic
1019829646 7:3314471-3314493 AGCATACACAAAGAGGCAAGTGG + Intronic
1020240612 7:6391771-6391793 TGCAGGCACAAGGAGGAAGGCGG - Intronic
1020648841 7:10850303-10850325 TCCCTACACAAAGATTAAAGAGG - Intergenic
1023502601 7:40866205-40866227 TGGGTTCACAAAGAGGTAAGAGG - Intergenic
1023928676 7:44690552-44690574 TGCATACACACATATGACAGAGG - Intronic
1024368843 7:48557045-48557067 TGCATAAACAAACAGGCAAAAGG + Intronic
1027236207 7:76299497-76299519 TGCCTACAAAGACAGGAAAGAGG + Intergenic
1028538732 7:91919254-91919276 TGCATAGACACAAATGAAAGTGG + Intergenic
1028709659 7:93892452-93892474 TGAATACAACAAGAGAAAAGGGG - Intronic
1028796974 7:94913841-94913863 TACAAACTCACAGAGGAAAGGGG - Intronic
1028825154 7:95263713-95263735 TGCATAGAAAAACTGGAAAGAGG - Intronic
1030764541 7:113393046-113393068 TGAAGAAACAAAGAGGCAAGAGG + Intergenic
1030918403 7:115346958-115346980 TGCATCCACAAACAGAAAAACGG + Intergenic
1032275995 7:130456104-130456126 TTCATCCACAAAAAGGAATGAGG - Intergenic
1032513417 7:132489895-132489917 TCTATACACAAAGAGGAATGTGG + Intronic
1032930108 7:136656483-136656505 TGGATACACTAAGAAGAAAAAGG - Intergenic
1034931197 7:155165473-155165495 TACATACACAATGATGAAAGTGG - Intergenic
1035354116 7:158266844-158266866 TGGCTGCACAAACAGGAAAGTGG + Intronic
1036115705 8:5958727-5958749 TCCAAAAACAGAGAGGAAAGGGG + Intergenic
1037243765 8:16807159-16807181 TCCCTGCACAAGGAGGAAAGTGG + Intergenic
1037620219 8:20556932-20556954 TGCAAACACAAAGATGGAAGCGG + Intergenic
1038667906 8:29557105-29557127 TAAATACATAAACAGGAAAGGGG + Intergenic
1038765394 8:30423369-30423391 TGCATACACAAAGAGGAAAGAGG - Intronic
1039622903 8:39016244-39016266 TGGAGACAGAAACAGGAAAGAGG - Intronic
1041178939 8:55227703-55227725 TGGAGACAGATAGAGGAAAGGGG + Intronic
1041548773 8:59077326-59077348 TGCATACTTAGAGAAGAAAGGGG - Intronic
1041981833 8:63871034-63871056 TGCAAACACACTGAGCAAAGAGG - Intergenic
1044687901 8:94845388-94845410 TGGATAGACAAATAGAAAAGTGG - Intronic
1046394385 8:113622324-113622346 TGCAAACACAAAGAAAAAAAAGG - Intergenic
1046469169 8:114646165-114646187 TGTATACATAAAGAGTAAAATGG + Intergenic
1047210483 8:122836326-122836348 TGCATGCACAGAGAGGCAACTGG + Intronic
1047961282 8:130013845-130013867 TACATCCTCAAAGAGCAAAGGGG + Intronic
1048213679 8:132477800-132477822 TGCATTAACAATGGGGAAAGGGG + Intronic
1048485284 8:134842133-134842155 TGCTTACAAATAGAGGAAAGTGG + Intergenic
1048692518 8:136983625-136983647 TGCAGACACAGGAAGGAAAGAGG - Intergenic
1048919659 8:139216565-139216587 TGTGTGCACAAAGAGGAGAGAGG - Intergenic
1049110356 8:140638412-140638434 TGCTTCTACAAAGAGGAAGGAGG + Intergenic
1049148976 8:141022158-141022180 AACATACCAAAAGAGGAAAGGGG + Intergenic
1049327233 8:142029098-142029120 TGAATCCACACAGAGGAATGAGG + Intergenic
1050004766 9:1118625-1118647 TAGATACACAGAGAGGAAAGTGG + Intergenic
1052079916 9:24192152-24192174 TGCAAACACAAATATGAAATGGG + Intergenic
1052080233 9:24196830-24196852 AGAACACACAAAGGGGAAAGAGG - Intergenic
1052478008 9:28986053-28986075 TGCATGCAGAAAAATGAAAGTGG - Intergenic
1053109487 9:35445453-35445475 TGCATAGACAAAAAGAAAAATGG - Intergenic
1055020292 9:71662370-71662392 TGTTTACAAAAAGAGGAATGTGG + Intergenic
1055540012 9:77293412-77293434 TGCATACACAGATATGAATGTGG + Exonic
1056214112 9:84392214-84392236 TACATAAATAAAAAGGAAAGAGG - Intergenic
1056615235 9:88160015-88160037 TTCATACACCAGGAGGAAGGAGG - Intergenic
1056782123 9:89558469-89558491 TACATACACAAAGAGAAATATGG - Intergenic
1058609586 9:106761120-106761142 TGAAGAAACAAAGTGGAAAGGGG - Intergenic
1058846332 9:108963307-108963329 CTCAAACACAAAGAGGAAGGGGG + Intronic
1060253973 9:122009976-122009998 TACAAAGACAAAGAGGAAGGTGG - Intronic
1060379565 9:123154394-123154416 AGCATACACAAGTGGGAAAGTGG + Intronic
1062164998 9:135103203-135103225 TGCACACACAAGGAGGGAAGAGG - Intronic
1203740792 Un_GL000216v2:175548-175570 TGGATAGACGAAGAGGAAGGGGG - Intergenic
1186256685 X:7729406-7729428 TCCATGCACCAAGAAGAAAGGGG - Intergenic
1186453358 X:9691549-9691571 AGCAAACACAAAGAGACAAGTGG - Intronic
1188886410 X:35556029-35556051 TGCATCCATAAAAAGGAATGAGG + Intergenic
1189222068 X:39381157-39381179 GGCAGATACAAAGGGGAAAGAGG + Intergenic
1189271966 X:39758240-39758262 TGAATCCACAAAGAGGAAATAGG - Intergenic
1190065172 X:47235413-47235435 TGCATATGTAAAGAGGAAAATGG - Intronic
1190432608 X:50392451-50392473 TGGAAGGACAAAGAGGAAAGGGG + Intronic
1192215795 X:69157210-69157232 GGGAGACACAGAGAGGAAAGGGG + Intergenic
1195274635 X:103269676-103269698 TACATACCCCAAAAGGAAAGAGG - Intergenic
1195292903 X:103446322-103446344 TGCCAGCAAAAAGAGGAAAGGGG + Intergenic
1196483245 X:116175717-116175739 TGCATTTTCAAAGAGAAAAGCGG - Intergenic
1196538734 X:116880378-116880400 TGTATACACAAAAAGTAAAAAGG - Intergenic
1197273286 X:124449224-124449246 TGTGTACAGAAAGGGGAAAGAGG + Intronic
1197538811 X:127728273-127728295 TGAGTACACACAGAGGAAACTGG - Intergenic
1198104658 X:133450748-133450770 TACAGATAGAAAGAGGAAAGTGG - Intergenic
1198187690 X:134270021-134270043 TGCTTACAGAAAGAGATAAGGGG + Intergenic
1198925898 X:141794940-141794962 TGCATCCAAAGAAAGGAAAGGGG + Intergenic
1199716705 X:150511980-150512002 TACATACAGAAAGAGAGAAGTGG - Intronic
1199856233 X:151761160-151761182 TGTATAGACAAAGAGCAAAGAGG - Intergenic
1200096476 X:153666626-153666648 TGCATTCACAAAGAGAAGTGGGG + Intergenic
1200849638 Y:7869727-7869749 TGAATACACAGAGAGAAAAAGGG + Intergenic
1202243437 Y:22793047-22793069 TGCATAGGCAAAGAGCAAATAGG - Intergenic
1202396424 Y:24426797-24426819 TGCATAGGCAAAGAGCAAATAGG - Intergenic
1202474358 Y:25243295-25243317 TGCATAGGCAAAGAGCAAATAGG + Intergenic