ID: 1038765397

View in Genome Browser
Species Human (GRCh38)
Location 8:30423376-30423398
Sequence CAGGCCCTGCATACACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 179}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038765397_1038765402 -1 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765402 8:30423398-30423420 GGTTGCCTAGCTACCTCGGAGGG No data
1038765397_1038765406 10 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765406 8:30423409-30423431 TACCTCGGAGGGGACAGTGAGGG No data
1038765397_1038765408 14 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765408 8:30423413-30423435 TCGGAGGGGACAGTGAGGGCTGG No data
1038765397_1038765412 26 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765412 8:30423425-30423447 GTGAGGGCTGGGCTGCAAAGGGG No data
1038765397_1038765409 15 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765409 8:30423414-30423436 CGGAGGGGACAGTGAGGGCTGGG No data
1038765397_1038765401 -2 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765401 8:30423397-30423419 TGGTTGCCTAGCTACCTCGGAGG No data
1038765397_1038765410 24 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765410 8:30423423-30423445 CAGTGAGGGCTGGGCTGCAAAGG No data
1038765397_1038765411 25 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765411 8:30423424-30423446 AGTGAGGGCTGGGCTGCAAAGGG No data
1038765397_1038765403 0 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765403 8:30423399-30423421 GTTGCCTAGCTACCTCGGAGGGG No data
1038765397_1038765413 30 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765413 8:30423429-30423451 GGGCTGGGCTGCAAAGGGGAAGG No data
1038765397_1038765399 -5 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765399 8:30423394-30423416 GCCTGGTTGCCTAGCTACCTCGG No data
1038765397_1038765405 9 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038765397 Original CRISPR CAGGCCCTGCATACACAAAG AGG (reversed) Intronic
902605465 1:17566662-17566684 CTGGCCCTGCATACTCCATGTGG - Intronic
905479828 1:38254135-38254157 CAGGCACTGCAGAGACAAAGAGG + Intergenic
908181536 1:61611001-61611023 TAGGCCCTGAATACACCAAATGG - Intergenic
910452496 1:87361316-87361338 CAAGCCCTGAAGAGACAAAGAGG + Intergenic
913990371 1:143606425-143606447 CAGGCTCTATATACACAAATTGG - Intergenic
916260589 1:162838394-162838416 CAGGCCCTGGGGACACAGAGAGG - Intronic
919086689 1:192929023-192929045 CAGGCCCTGCCTACACTAAGGGG - Intergenic
920765683 1:208831517-208831539 CAAGCCCTCACTACACAAAGAGG + Intergenic
921172270 1:212560133-212560155 CAGGCCCTGCAAGCACAGGGTGG - Intergenic
922696584 1:227733917-227733939 CAGGCCCCGCGTAGACAAAGCGG + Exonic
923225389 1:231934367-231934389 CACGCCCTGGATACACACGGAGG - Intronic
923274923 1:232387330-232387352 CAGGGGCTGCAGACACACAGGGG + Intergenic
924724591 1:246657430-246657452 CAGGCCCTGCTGAAACAAAAGGG + Intronic
1062804752 10:409532-409554 CAGGCACTTCATGCACTAAGAGG - Intronic
1064472818 10:15654136-15654158 CAGGCCATGAAAACACACAGAGG - Intronic
1065878369 10:30017472-30017494 CAGGCCATGGAGACACAGAGGGG + Exonic
1068482087 10:57604338-57604360 CAGAACCTGCATAAACAAAATGG + Intergenic
1068675182 10:59763148-59763170 CAGACACTGCATACAGGAAGTGG - Intergenic
1070509034 10:77142748-77142770 CAGGTCCTACAAACACTAAGAGG + Intronic
1072744198 10:97928533-97928555 CAGGCGCTTCATACGTAAAGGGG - Intronic
1073138856 10:101234687-101234709 CCAGCCCAGCATACACCAAGGGG + Intergenic
1074611611 10:115027288-115027310 CTGGTTCTGCATACACAATGAGG + Intergenic
1075059864 10:119248650-119248672 CAGGCCCTACAGAAACACAGCGG - Intronic
1075426262 10:122343978-122344000 CAGGCCCTGCTTGCACACGGGGG + Intergenic
1076305503 10:129463218-129463240 CAGGCCCTGCACCCACAAACTGG + Intergenic
1083212836 11:61199688-61199710 CAAGTCCTGCCTACACAAAAGGG + Intergenic
1083215777 11:61218851-61218873 CAAGTCCTGCCTACACAAAAGGG + Intergenic
1083218661 11:61237680-61237702 CAAGTCCTGCCTACACAAAAGGG + Intergenic
1083288478 11:61676340-61676362 CAGCGTCTGCATCCACAAAGGGG - Intergenic
1083443302 11:62690862-62690884 CAGGCCCTGCACCTCCAAAGAGG + Exonic
1083608181 11:63991499-63991521 CAGGCACAGCATACAGAATGCGG - Intronic
1084596180 11:70118344-70118366 CAGGCCCAGCAAACACAATGCGG + Intronic
1085720564 11:78908868-78908890 AAGTCCCTGCATACAACAAGGGG - Intronic
1086239116 11:84668073-84668095 CTGGCACTTCATACTCAAAGTGG - Intronic
1088682901 11:112259612-112259634 CAGGCTTTTCATACATAAAGTGG + Intronic
1089864490 11:121619940-121619962 CAGGCCAGGAATAAACAAAGAGG - Intronic
1090324658 11:125874495-125874517 CAAACACTGCATACACAGAGAGG - Intergenic
1093395106 12:18671407-18671429 CAGTCCCTTATTACACAAAGGGG - Intergenic
1097396986 12:59087268-59087290 CAGGCACTGCAGACAGAAGGGGG - Intergenic
1097773334 12:63616160-63616182 CAATCCCTGCAGACACGAAGGGG + Intronic
1100095378 12:91027480-91027502 CAGGCCCTACCTCCACAATGGGG - Intergenic
1104001244 12:124862080-124862102 GGGACCCTGCATACACACAGTGG + Intronic
1106906213 13:34412304-34412326 CATGCACTGCATATCCAAAGGGG - Intergenic
1107365547 13:39669532-39669554 CAGGCACTGCAAATACAAAAAGG - Intronic
1111096926 13:83528481-83528503 CAGCCCCTGCATAAGCAAATAGG + Intergenic
1112548404 13:100394872-100394894 CAGACCCTGGACACACAAACTGG - Intronic
1114368836 14:22062353-22062375 CAGACCCTGCAGACATAAAAAGG - Intergenic
1116832307 14:49733191-49733213 AAGGCCCTGGAAATACAAAGTGG + Intronic
1117314733 14:54563641-54563663 CAGGCACTGAATACACGATGGGG - Intergenic
1117348526 14:54858206-54858228 CAGGGCCTGCATAAAGAAACAGG + Intronic
1119523916 14:75307311-75307333 CATGGCCAGCATATACAAAGAGG + Intergenic
1120950104 14:90033089-90033111 TAGACCCTGCAGACACACAGAGG - Exonic
1122410222 14:101521922-101521944 CAGGCCCTGCACACAGTAAGTGG - Intergenic
1122471428 14:101969538-101969560 CAGCTCCAGCAGACACAAAGAGG + Intronic
1124168918 15:27354515-27354537 CAAGCCCTGCATCCACACACAGG - Intronic
1128090161 15:64913774-64913796 CTGTCCCTGGATACACAAAGGGG + Intronic
1128239647 15:66093252-66093274 CATGCACTGCATAGACAGAGAGG + Intronic
1130411636 15:83653533-83653555 CAGGCCCAGCAGCCACACAGAGG - Intergenic
1130900800 15:88205709-88205731 CAGGCCCTGAATAAATAAAATGG + Intronic
1132473411 16:119673-119695 CAGGCCCTTCACCCACAGAGCGG + Intronic
1134448422 16:14348044-14348066 CAGGCGCTGCTTACAGAAGGAGG - Intergenic
1134664991 16:16012337-16012359 CAGGCTCTGAGGACACAAAGGGG - Intronic
1135400607 16:22163947-22163969 CAGGCCCTACATATACAGATAGG - Intergenic
1136401756 16:30023119-30023141 CAGCCCCAGCATTTACAAAGAGG - Intronic
1138555886 16:57771026-57771048 CTGGCCCTGGATACAGGAAGGGG + Intronic
1139714620 16:68802893-68802915 CAGGCACTGCAAATACAATGGGG - Intronic
1141697392 16:85626539-85626561 CAGGCCCCGCACACACAATCTGG - Intronic
1142080392 16:88145995-88146017 CAAGCCCAGAAAACACAAAGTGG - Intergenic
1142132018 16:88435504-88435526 CAGGCCCTCCTTCCACAGAGAGG - Exonic
1142425360 16:89999661-89999683 CAGGCCCCCCATACACCATGGGG - Intergenic
1142743970 17:1945935-1945957 CAGGCGCTCCATAAACAGAGGGG + Intronic
1142854782 17:2723671-2723693 CAGTCCCTGCATACCCAGCGGGG + Intergenic
1146916172 17:36679850-36679872 CAGACCCTGCAAACACACATAGG - Intergenic
1147851897 17:43450180-43450202 CTGGCCTTGCACACACACAGTGG - Intergenic
1148044825 17:44736991-44737013 CAGGCCCTGGAAACACAAAGGGG - Intronic
1150280928 17:63929319-63929341 CAGGCCCTGGAGACATTAAGTGG + Exonic
1151350119 17:73526947-73526969 TAGGCCCTGGCAACACAAAGAGG + Intronic
1153464213 18:5371008-5371030 AAGGTCCTGAAAACACAAAGTGG - Intergenic
1153541641 18:6161871-6161893 CAGTCCCTTCAGACACAAATTGG + Intronic
1155184161 18:23372830-23372852 CAGGCTCTGGGGACACAAAGAGG - Intronic
1156400510 18:36735300-36735322 CAGGTGCTGGATACACACAGAGG + Intronic
1160531522 18:79567742-79567764 CAGGCCCTGCATTTAGAAAGAGG - Intergenic
1163109850 19:15152989-15153011 CAGACCCTGCATGCACAGAGCGG + Intergenic
1163581804 19:18143909-18143931 CAGGCCCTGCAGGCCCCAAGAGG + Exonic
1168182405 19:54671309-54671331 CAGGCACTGCATTCAGGAAGGGG + Intronic
927813123 2:26191390-26191412 AAGGCCCTGAATAGAGAAAGAGG + Exonic
927872926 2:26635003-26635025 CAGACCCTGCAGACCCAAAGAGG - Intronic
931797930 2:65729521-65729543 CAGGCCCTACATAAGCAGAGAGG + Intergenic
931805786 2:65802715-65802737 CAGGCCCAGCATAAGGAAAGAGG - Intergenic
932697523 2:73969158-73969180 CAGGCACTGGAGATACAAAGTGG - Intergenic
933655809 2:84886100-84886122 CACGGACTGCATACACAGAGGGG + Intronic
936075594 2:109399749-109399771 CAGTCTCTGCATTCATAAAGGGG - Intronic
937076081 2:119107926-119107948 AAGGCCCTGGATTCAGAAAGTGG + Intergenic
937118780 2:119427895-119427917 AAGGCCCTGCAGACACCCAGGGG + Intergenic
938108742 2:128550526-128550548 CAGGCCCCACATCCACTAAGAGG - Intergenic
940311574 2:152284862-152284884 CAGGCCCTGGGAACAGAAAGGGG - Intergenic
945154753 2:206826975-206826997 TAGGCCCTGGAAACACAAAGGGG - Intergenic
946272803 2:218608297-218608319 CTGGCCCTGCATAAGCTAAGAGG - Intronic
946534591 2:220612463-220612485 CAGACCCTGCATAAACAATTTGG + Intergenic
1168924613 20:1569011-1569033 CAGACCCTGCAGACACCAAAAGG + Intronic
1170594525 20:17794957-17794979 CAGGCCCCTCAGAGACAAAGAGG + Intergenic
1171161167 20:22925048-22925070 CAGACCCTGCATCCATAAAGTGG - Intergenic
1171208654 20:23300504-23300526 CACACACTGCATACACAGAGGGG + Intergenic
1171453828 20:25255387-25255409 CAGCCCCTCCAGACACAAAGGGG - Intronic
1172082992 20:32357679-32357701 CAGGCTCTGCAAATACACAGCGG + Intergenic
1172135744 20:32685555-32685577 CAGGCCTTGCAAACCCAGAGTGG + Intergenic
1173111989 20:40199777-40199799 CAGAACCTGTAAACACAAAGAGG + Intergenic
1173933059 20:46837913-46837935 CAGGCCAGGCAAAGACAAAGTGG + Intergenic
1174431843 20:50475782-50475804 GAAGCCCCGCATAAACAAAGAGG - Intergenic
1175011339 20:55740299-55740321 CAAGCCCTGCATCCCCAATGAGG - Intergenic
1175785683 20:61710419-61710441 CAGGGCCTGCACACAGATAGAGG - Intronic
1176085668 20:63294423-63294445 CAGGCCCGGCCCACTCAAAGGGG - Intronic
1176156169 20:63622308-63622330 CTGGCCCTGCACTCACTAAGGGG + Intronic
1176330587 21:5545670-5545692 CATGGACTGCATACACACAGAGG + Intergenic
1176397170 21:6275281-6275303 CATGGACTGCATACACACAGAGG - Intergenic
1176439987 21:6713823-6713845 CATGGACTGCATACACACAGAGG + Intergenic
1176464249 21:7040892-7040914 CATGGACTGCATACACACAGAGG + Intergenic
1176487810 21:7422671-7422693 CATGGACTGCATACACACAGAGG + Intergenic
1177744906 21:25200066-25200088 TATACCCTGCACACACAAAGAGG - Intergenic
1179796441 21:43787421-43787443 GAGGCCCTGCACTCACACAGTGG - Intergenic
1181629213 22:24141736-24141758 CAGACCCTGGGTAGACAAAGGGG - Intronic
1183656122 22:39185676-39185698 TGGGGCCTGCATAGACAAAGCGG + Intergenic
1184419641 22:44372229-44372251 CAGGCTCTGCCTACTCACAGAGG + Intergenic
1185241306 22:49749011-49749033 CAGGCCCTGAGTACAGAAGGTGG - Intergenic
950184084 3:10934413-10934435 CAGGTGCTGCATACGCAAATCGG + Intronic
950660031 3:14461531-14461553 CAAGCCCTGCAGACGCACAGGGG + Intronic
952619419 3:35319312-35319334 CACTCCCTTCATACACAAAATGG - Intergenic
955084764 3:55692207-55692229 CTGGCCCTGCATTCACAGAGAGG + Intronic
956475799 3:69618954-69618976 CAGGTCCTGCCCACACTAAGGGG + Intergenic
956505049 3:69929132-69929154 CAACCCCTGCCTACACAATGTGG + Intronic
959748132 3:109801434-109801456 CAGGGGCTGCATGCCCAAAGAGG + Intergenic
961354870 3:126331173-126331195 CAGGCCCTGCATCCAGAAGAGGG - Intergenic
962712988 3:138103077-138103099 CACACCCTACATACACACAGAGG + Intronic
963944939 3:151135526-151135548 CAGGTCCCTCATACACAAAATGG - Intronic
965949343 3:174286805-174286827 CTTGCCCTGCATTCACCAAGAGG - Intergenic
968448638 4:664864-664886 ATGGCCCTGCAGACACAAACCGG - Exonic
968951021 4:3691521-3691543 GAGGCCATGCAGAAACAAAGTGG - Intergenic
969284708 4:6195875-6195897 CAGACCATACATACACAAATGGG + Intronic
971017229 4:22500896-22500918 GAGGGCCTGAATAAACAAAGAGG + Intronic
971628354 4:28954707-28954729 CAGGTCATGGATACACTAAGAGG - Intergenic
971942826 4:33237664-33237686 GAGACCCTGCATTCAAAAAGGGG + Intergenic
973948122 4:55981477-55981499 CAGGCCATACATAAACAAAGTGG - Intronic
974077655 4:57182370-57182392 CAGGCCCTGGGAAGACAAAGAGG - Intergenic
974601271 4:64083754-64083776 CAGTCACTGCTTACAGAAAGGGG + Intergenic
978277247 4:106967151-106967173 CAGGCACTGGCTACACAAAGTGG + Intronic
985651213 5:1108651-1108673 AAGTCCCTGCATCCCCAAAGGGG + Intronic
986602182 5:9483486-9483508 CAAGCTCTGCATGCATAAAGAGG + Intronic
988888714 5:35589919-35589941 CGCGCACTGCATACACACAGTGG - Intergenic
992724046 5:79588881-79588903 CAGTCCCTACCCACACAAAGTGG - Intergenic
994675630 5:102817931-102817953 CAGGCCCTGCAGACACCTGGAGG - Intronic
998544148 5:143011662-143011684 CAGCACCTGCACAAACAAAGGGG - Intronic
1001321955 5:170689965-170689987 CAGGCCTTGCATACAAAAGAAGG - Intronic
1001527862 5:172441521-172441543 CAGGCCCTGAAGACAAAATGGGG + Intronic
1002450126 5:179314115-179314137 CAGGCTCTGCATCCACACGGAGG + Intronic
1007075685 6:39064771-39064793 CAGGCCCTGCAGAGGCAAGGCGG - Intronic
1007162119 6:39800300-39800322 CAGGCCCAGGAGACACAAGGAGG - Intronic
1012004055 6:93690778-93690800 GAGTGCCTGCATACACACAGTGG + Intergenic
1015952797 6:138570934-138570956 CAGTCCCTACACACACTAAGAGG + Intronic
1018204676 6:161426190-161426212 CTGCCCCTGAATACCCAAAGGGG + Intronic
1018952293 6:168387075-168387097 CATGCCCTGCATATACAACATGG - Intergenic
1021117072 7:16755670-16755692 CAGTGCCTGCTTACACAGAGTGG + Intronic
1022044459 7:26612021-26612043 CAGGCCCCACATACACACTGGGG - Intergenic
1022473405 7:30695111-30695133 CAGGCCCTGCACAGACATAGGGG + Intronic
1022537871 7:31109147-31109169 CTGGCCCTGCATCCTCATAGAGG + Exonic
1022587364 7:31627174-31627196 CAGGCACTGCATGGACAACGGGG - Intronic
1022774267 7:33508740-33508762 CAAGCTCTGCAGTCACAAAGGGG - Intronic
1022932900 7:35139889-35139911 CAATCCCTGCAGACACGAAGGGG + Intergenic
1023867130 7:44243658-44243680 CATGCCCTGCAGACACCATGGGG - Intronic
1024674522 7:51626233-51626255 CAGGCTGTGAATACACCAAGAGG + Intergenic
1026849028 7:73713426-73713448 CGGGCACTGTATACATAAAGTGG + Intronic
1028351535 7:89856380-89856402 CAGACACTGCCTACACAAGGTGG + Intergenic
1029828818 7:103232654-103232676 CAATCCCTGCAGACACGAAGGGG + Intergenic
1036740908 8:11360969-11360991 CCAGCCCTGTATACACAGAGTGG - Intergenic
1037783713 8:21889286-21889308 GAGACCCTGCAGAGACAAAGGGG + Intergenic
1038765397 8:30423376-30423398 CAGGCCCTGCATACACAAAGAGG - Intronic
1039793718 8:40895294-40895316 CGGTCCTTGCATACACAAACAGG + Intronic
1039949324 8:42155658-42155680 CCGGCCCTGGATTCACACAGAGG + Intronic
1045674630 8:104593583-104593605 CATCCCCTGCATATACCAAGGGG - Intronic
1046269949 8:111881828-111881850 GAGGAACTGCATATACAAAGGGG - Intergenic
1046628782 8:116603115-116603137 CATGTCCTGCATAGGCAAAGAGG + Intergenic
1047598906 8:126407095-126407117 CAGGTTCTCCATACACAAAGTGG - Intergenic
1048535966 8:135294865-135294887 CAGGCCCTGACTCCACTAAGAGG - Intergenic
1051257822 9:15232979-15233001 CAAACACTGCATACACAGAGAGG + Intronic
1052031158 9:23630528-23630550 CAGGGCCTGCTTCCTCAAAGTGG + Intergenic
1056744106 9:89285339-89285361 CAGGCCCTGGAGAGACAAAAAGG + Intergenic
1057561173 9:96129112-96129134 CAGGCTCTGCATACACAGTTTGG + Intergenic
1058447060 9:105063923-105063945 CATTCCCTTCATAAACAAAGAGG + Intergenic
1059820176 9:117963775-117963797 CAGGCCCCTCAGAGACAAAGGGG - Intergenic
1203431508 Un_GL000195v1:94656-94678 CATGGACTGCATACACACAGAGG - Intergenic
1187473297 X:19588369-19588391 TAGGCCCTGCTCACACACAGGGG - Intronic
1188120854 X:26305557-26305579 CAGGCCCCACCTACACTAAGGGG + Intergenic
1189403893 X:40700188-40700210 CATGCCCTGAATACAAAAATTGG + Intronic
1190318143 X:49164186-49164208 CAGGCCCTGCCTCCTCAAAAAGG - Intronic
1190476683 X:50835032-50835054 CAGGCCCTGCATAAGCATTGAGG - Intergenic
1196049512 X:111290056-111290078 CAGGCCATGCATCCACACTGAGG - Intergenic
1197730501 X:129805396-129805418 GAGGCCCTGAATGCACAAATGGG - Exonic
1197777617 X:130129677-130129699 CAGGCCATGCCCACACAATGGGG + Intronic
1199328719 X:146533252-146533274 CTGGCCATGCCTACACAAATTGG - Intergenic
1199685313 X:150260121-150260143 CAGGCCCAGCCCCCACAAAGGGG + Intergenic