ID: 1038765400

View in Genome Browser
Species Human (GRCh38)
Location 8:30423395-30423417
Sequence TCCGAGGTAGCTAGGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038765400_1038765409 -4 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765409 8:30423414-30423436 CGGAGGGGACAGTGAGGGCTGGG No data
1038765400_1038765408 -5 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765408 8:30423413-30423435 TCGGAGGGGACAGTGAGGGCTGG No data
1038765400_1038765411 6 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765411 8:30423424-30423446 AGTGAGGGCTGGGCTGCAAAGGG No data
1038765400_1038765406 -9 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765406 8:30423409-30423431 TACCTCGGAGGGGACAGTGAGGG No data
1038765400_1038765414 16 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765414 8:30423434-30423456 GGGCTGCAAAGGGGAAGGCCTGG No data
1038765400_1038765412 7 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765412 8:30423425-30423447 GTGAGGGCTGGGCTGCAAAGGGG No data
1038765400_1038765413 11 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765413 8:30423429-30423451 GGGCTGGGCTGCAAAGGGGAAGG No data
1038765400_1038765405 -10 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data
1038765400_1038765410 5 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765410 8:30423423-30423445 CAGTGAGGGCTGGGCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038765400 Original CRISPR TCCGAGGTAGCTAGGCAACC AGG (reversed) Intronic
902988278 1:20169040-20169062 CCCCCGGTTGCTAGGCAACCTGG + Intronic
903209369 1:21808151-21808173 TCCCAGGTAGCTGGGAATCCAGG + Intergenic
918292241 1:183120043-183120065 TCCGAGGTAGCTAGGACCACAGG - Intronic
1065981784 10:30904801-30904823 TCCGAGTTATCTAGGCAAAAAGG - Intronic
1070751646 10:78967499-78967521 TAAGAGCTATCTAGGCAACCAGG + Intergenic
1078642357 11:13108559-13108581 TTCCAGGTAGCTGGACAACCTGG + Intergenic
1084364603 11:68689518-68689540 TCCCAGGTAGCTGGGAAAACAGG + Intronic
1084426335 11:69086314-69086336 GCCGAGGTAGCTAAGCCAGCAGG - Intronic
1087032484 11:93719389-93719411 TCCGAGGTAGCTAGGACTACAGG + Intronic
1089255987 11:117194189-117194211 TCCGAGGTAGCTAGGACTACTGG - Intronic
1090348808 11:126093219-126093241 TCCCAAGTAGCTAGGACACCAGG + Intergenic
1103615406 12:122148633-122148655 TCCGAGGTAGCGAGGCTACATGG + Intergenic
1108808349 13:54187430-54187452 TCCCAGGTAGCTAGGACAACAGG - Intergenic
1110955047 13:81543940-81543962 TCCTAAGTAGCTAGGACACCAGG - Intergenic
1112799767 13:103097611-103097633 TCCGAGGAAGCTTGGCCAACTGG - Intergenic
1115479759 14:33849833-33849855 TCCGAAGTAGCTAGGAATACAGG + Intergenic
1120268651 14:82282390-82282412 TCCCAGGTAGCTAGGACAACAGG - Intergenic
1125537342 15:40449474-40449496 CCAGAGGTAGCTGGGCAACTTGG + Intronic
1126842980 15:52735040-52735062 TCCCAGGTAGCTAGGAATACAGG - Intergenic
1129253887 15:74323114-74323136 TCAAAGGTAGCTAGGAAAACAGG - Intronic
1135547386 16:23375312-23375334 ACCGAGGAAGCTAGGCAGGCTGG - Intronic
1136536024 16:30900008-30900030 TCAGAGGTAGCCAGGTAGCCTGG + Intronic
1137909722 16:52364563-52364585 TCTGAGAGAGCTAGGAAACCTGG - Intergenic
1140088865 16:71820509-71820531 TCCGAAGTAGCTAGGAATACAGG + Intergenic
1148378854 17:47177173-47177195 TCCCAGGTAGCTAGGAATACAGG - Intronic
1150815873 17:68391409-68391431 TCAGAGGTACCTAGTCCACCTGG - Intronic
1152298753 17:79483463-79483485 TCCGAGGCAGGTAGGCAGGCAGG - Intronic
1158061258 18:53346115-53346137 TCCTAAGTAGCTAGGAAAACAGG + Intronic
1159097445 18:63920411-63920433 TCAAAGGTAGTTAGGCATCCTGG + Intronic
1160578236 18:79869148-79869170 TCCGAGGTATCCAGGAGACCCGG - Intronic
1161673414 19:5627342-5627364 TCCCAAGTAGCTAGGAAAACAGG - Intronic
1163479211 19:17544708-17544730 TCCTAGGTACCTAGGCACACAGG + Intronic
1167427791 19:49438390-49438412 TCTGAGGTGGGTAGGCAGCCAGG + Intronic
931544989 2:63372997-63373019 TCCGAGGTAGCTAGGATTACAGG - Intronic
942942885 2:181640113-181640135 TCAGAGGTAGACAGGCAATCAGG - Intronic
1171467569 20:25341292-25341314 TCTGAGCTAGCTGGGCTACCAGG + Intronic
1174440516 20:50548547-50548569 TCCCAGGTAGCTAGGAATACAGG + Intronic
1181286125 22:21753784-21753806 TCAGAGATAGCAAGGCCACCTGG - Intergenic
1182934802 22:34210807-34210829 TCGCAGGTTGCTAGGCAAACTGG - Intergenic
951018685 3:17758149-17758171 TCTCAGGTAGCTAGGCCAACAGG + Intronic
951696158 3:25447665-25447687 TCTGAGGGGGCTAGGCAGCCTGG + Intronic
967986847 3:195101700-195101722 TCCCAGGTAGCTAGGATAACAGG - Intronic
975584972 4:75940465-75940487 TCCTTGGTAGCTATGCAGCCCGG + Intronic
989500255 5:42158206-42158228 CCCTAGGTAGCTAGGAAAACAGG + Intergenic
998572246 5:143272442-143272464 TCCCAAGTAGCTAGGAAAACAGG + Intergenic
1000454643 5:161434768-161434790 CCCTAGGTAGCTAGGTATCCTGG + Intronic
1013242570 6:108260328-108260350 CCAGAGGTAGCAAGCCAACCCGG - Intronic
1014440671 6:121470290-121470312 TCCGAAGTAGCTAGGACAACAGG - Intergenic
1014646314 6:123977285-123977307 TCCCAAGTAGCTAGGCATACAGG - Intronic
1021550078 7:21861789-21861811 TCGGGGGTAGCTAGACATCCAGG + Intronic
1021993026 7:26154672-26154694 TCCCAGGTAGCTAGGAGAACTGG + Intronic
1023059736 7:36315880-36315902 TCAGGGGTAGCCAGGCCACCGGG + Intergenic
1024474549 7:49796555-49796577 TCCCAGGTAGGTAGGCATCCCGG + Intronic
1028029483 7:85892143-85892165 TCCCAGGTAGCTGGGAAAACTGG - Intergenic
1038765400 8:30423395-30423417 TCCGAGGTAGCTAGGCAACCAGG - Intronic
1040753963 8:50747856-50747878 TCCCAGGTAGCTAGGCCTACAGG + Intronic
1041108897 8:54467305-54467327 CCCGAGGGAGCTCGGCAACTCGG - Intergenic
1042398728 8:68320926-68320948 TCCCAGGTAGCTAGGACTCCAGG + Intronic
1048907239 8:139099978-139100000 TCCAGGGTAGCTAAGCATCCTGG - Intergenic
1050244736 9:3676837-3676859 TCTGAGGTAGCAAGGCTGCCAGG - Intergenic
1052032519 9:23644679-23644701 TCCAAGGTTGCTGGGCAAGCAGG - Intergenic
1188396956 X:29696571-29696593 TCCATGCTAGGTAGGCAACCTGG - Intronic
1194427687 X:93760167-93760189 TCTGAGGTATTTAGGAAACCAGG + Intergenic
1200989866 Y:9337280-9337302 TGCCGGGTAGCTAGGCATCCGGG - Intergenic
1200992534 Y:9357613-9357635 TGCCGGGTAGCTAGGCATCCGGG - Intergenic
1200995186 Y:9377891-9377913 TGCCGGGTAGCTAGGCATCCGGG - Intronic
1200997851 Y:9398237-9398259 TGCCGGGTAGCTAGGCATCCGGG - Intergenic
1201000360 Y:9466770-9466792 TGCCGGGTAGCTAGGCATCCGGG - Intergenic
1201003022 Y:9487083-9487105 TGCCGGGTAGCTAGGCATCCGGG - Intronic
1201005681 Y:9507366-9507388 TGCCGGGTAGCTAGGCATCCGGG - Intergenic
1201008341 Y:9527696-9527718 TGCCGGGTAGCTAGGCATCCGGG - Intergenic