ID: 1038765405

View in Genome Browser
Species Human (GRCh38)
Location 8:30423408-30423430
Sequence CTACCTCGGAGGGGACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038765397_1038765405 9 Left 1038765397 8:30423376-30423398 CCTCTTTGTGTATGCAGGGCCTG 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data
1038765400_1038765405 -10 Left 1038765400 8:30423395-30423417 CCTGGTTGCCTAGCTACCTCGGA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data
1038765394_1038765405 16 Left 1038765394 8:30423369-30423391 CCTCTTTCCTCTTTGTGTATGCA 0: 1
1: 0
2: 5
3: 38
4: 354
Right 1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038765405 Original CRISPR CTACCTCGGAGGGGACAGTG AGG Intronic
No off target data available for this crispr