ID: 1038766184

View in Genome Browser
Species Human (GRCh38)
Location 8:30429985-30430007
Sequence TCTGAAATCTGGCCCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038766180_1038766184 22 Left 1038766180 8:30429940-30429962 CCATATAGTTACAGAATCTATAC 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1038766184 8:30429985-30430007 TCTGAAATCTGGCCCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038766184 Original CRISPR TCTGAAATCTGGCCCGGCGC AGG Intronic
No off target data available for this crispr