ID: 1038767570

View in Genome Browser
Species Human (GRCh38)
Location 8:30443126-30443148
Sequence TCGGGTTGTGGAGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038767570_1038767576 22 Left 1038767570 8:30443126-30443148 CCTGCAGCTTCTCCACAACCCGA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1038767576 8:30443171-30443193 ATTGCCTTTTTGTAAAATATTGG No data
1038767570_1038767575 -3 Left 1038767570 8:30443126-30443148 CCTGCAGCTTCTCCACAACCCGA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1038767575 8:30443146-30443168 CGAATCTGGAATATGTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038767570 Original CRISPR TCGGGTTGTGGAGAAGCTGC AGG (reversed) Intronic
900246055 1:1636630-1636652 TGGGGTTGTGGAGGAGTTGCAGG - Intronic
902273650 1:15324448-15324470 TCAGGTTGAAGAGAAGCTTCAGG + Exonic
903492967 1:23743524-23743546 CCAAGTTGTGGAGAAGCTGCAGG + Exonic
904382366 1:30119977-30119999 TCGGGTAGAGCAGGAGCTGCTGG + Intergenic
906509793 1:46404534-46404556 TGGGGTTGAGGAGAGACTGCTGG + Intronic
907966593 1:59336768-59336790 TGGAGTTGTGGAGAATCTGTAGG + Intronic
908773007 1:67613117-67613139 TAGGGGTCTGGAGGAGCTGCTGG + Intergenic
923490275 1:234478410-234478432 CCGCGTAGAGGAGAAGCTGCTGG - Exonic
1066477888 10:35765295-35765317 CGGAGGTGTGGAGAAGCTGCTGG - Intergenic
1069505392 10:68992915-68992937 TAGGGTTGGGGAGGGGCTGCAGG + Intronic
1069957182 10:72059511-72059533 TGGGGTCGTCGAGAGGCTGCGGG - Exonic
1071238784 10:83680739-83680761 TCGGGTGGTGAGAAAGCTGCAGG + Intergenic
1071273830 10:84034551-84034573 TGGGGGTGTGGGGAAGCAGCTGG + Intergenic
1072430661 10:95368080-95368102 GAGGGCTGTGGAGAAGCTGGTGG - Intronic
1074603569 10:114938514-114938536 TCGGTTGAAGGAGAAGCTGCTGG + Exonic
1076727098 10:132419101-132419123 TGGGCTTGGGGAGGAGCTGCAGG - Intergenic
1083839289 11:65294568-65294590 TCCGTTTATGGAGAGGCTGCAGG - Exonic
1084691980 11:70732806-70732828 TGGGGATGTGAAGCAGCTGCAGG - Intronic
1091927760 12:4369891-4369913 TAGGGCAGTGGAGAAGCTTCTGG + Exonic
1092966415 12:13647873-13647895 TAGTATTGAGGAGAAGCTGCGGG - Intronic
1095557039 12:43519879-43519901 TTGGGAGGTGGAGAGGCTGCAGG - Intronic
1098641582 12:72844834-72844856 CAAGGTTGTGGAGAATCTGCTGG + Intergenic
1100437419 12:94584360-94584382 TCTGGTTCTGGGGAGGCTGCGGG - Intronic
1101449193 12:104761093-104761115 GCGGGGTCTGGAGGAGCTGCGGG - Exonic
1101649301 12:106660342-106660364 GCTGGTTGTGGAAAAGCTCCAGG + Intronic
1102541048 12:113619413-113619435 GCCGGGTGTGGAGAAGCTGCTGG - Intergenic
1102738473 12:115184714-115184736 TTGGGTTCTGGAGATGCAGCAGG - Intergenic
1104346828 12:128007545-128007567 ACAGGTTGTGGAAATGCTGCAGG + Intergenic
1104652061 12:130542263-130542285 TGGGGTTTTGGAGAAGCAGCAGG + Intronic
1105962662 13:25356139-25356161 CAGTGGTGTGGAGAAGCTGCAGG + Intergenic
1107276815 13:38687905-38687927 TCTGGTCGTGGAAGAGCTGCTGG + Exonic
1107435181 13:40375429-40375451 TCAGGCTGTGGAGCAGCTGGGGG + Intergenic
1109154150 13:58883756-58883778 TCAGGCTGTGGAGAATGTGCAGG + Intergenic
1113574191 13:111382602-111382624 TGGGGTTGTGGAGATGCTGAGGG + Intergenic
1117740309 14:58811876-58811898 TTGGGTAGTGGAGAGGCTGAAGG + Intergenic
1121836534 14:97097476-97097498 TCTGGGGGTGGAGAAGATGCTGG - Intergenic
1122969416 14:105146475-105146497 TCGGGTTCGGGAGATCCTGCTGG - Exonic
1125439871 15:39690528-39690550 TAGGGCTGTGGAGCAGCTTCAGG - Intronic
1128649073 15:69397315-69397337 GAGGCTGGTGGAGAAGCTGCTGG + Intronic
1129267948 15:74404055-74404077 CTGGATTGTGGAGGAGCTGCCGG + Intergenic
1129689419 15:77705002-77705024 TCTCCTTGTGGAGAAGTTGCTGG + Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130083885 15:80761189-80761211 TGGGGGTGTGGAGGAGGTGCAGG + Intergenic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1132734505 16:1378890-1378912 TGAGGTGGGGGAGAAGCTGCGGG - Intronic
1132904516 16:2275599-2275621 TCTGGTGGGAGAGAAGCTGCTGG - Intergenic
1134359490 16:13517992-13518014 CCGGGTTGCTGAGCAGCTGCTGG + Intergenic
1135590332 16:23700674-23700696 GCAGGTGGTGGAGAAGCAGCAGG - Exonic
1136232546 16:28895082-28895104 TCAGCCTGTGGAGAAGCTGCAGG - Intronic
1136577731 16:31134344-31134366 TGGGGCTGTGGAGAGGATGCAGG - Intronic
1140321312 16:73954450-73954472 TCAGGTTGTTGGGAACCTGCGGG - Intergenic
1141629034 16:85276903-85276925 CCGGGCTCTGGAGAAGGTGCTGG + Intergenic
1142261106 16:89042790-89042812 TCTGGTTGCTGTGAAGCTGCTGG + Intergenic
1142448986 16:90162758-90162780 TCGGGGCCTGGAGAGGCTGCCGG - Intergenic
1142875099 17:2847571-2847593 TAGGGTTTTGGAGAGTCTGCTGG + Intronic
1142893357 17:2959275-2959297 TTGTGTTGTGTAGAGGCTGCAGG + Intronic
1146744408 17:35314754-35314776 TAGGGTTGTGCAGAAGAGGCTGG + Intergenic
1147585763 17:41653229-41653251 TCCTGTGGTGGAGAAGATGCAGG + Intergenic
1151667122 17:75551376-75551398 TCTGGTCGTGGATGAGCTGCTGG - Intronic
1151855445 17:76718275-76718297 TCAGGTTCTGCAGAAGATGCCGG + Intronic
1152448765 17:80363251-80363273 TCAGGCTGTGGAGAACCTGAGGG - Exonic
1154300295 18:13186067-13186089 TCTGGCTGTGGAGCAGCCGCTGG + Intergenic
1157357668 18:46950330-46950352 TAGGGGTCTGGAGAAGCTGGAGG + Intronic
1161091134 19:2360520-2360542 CGGGGTTGTGGAGAGGCAGCCGG + Intergenic
1161122585 19:2537674-2537696 GGGGGTTGTGGTGAAGCTGGAGG + Intronic
1161283439 19:3457497-3457519 TCGGGTTATGGGTAAGCAGCTGG + Intronic
1161535612 19:4817126-4817148 GCGGGTTCGGGAGAAGCTGGAGG - Exonic
1161728491 19:5944688-5944710 TCGGGCTGTGCAGAGGCTGCTGG - Intronic
1162110519 19:8397427-8397449 TCGGGGTGTGGAGCCCCTGCAGG + Intronic
1162379505 19:10323211-10323233 CCAGGTTGTTGAGCAGCTGCAGG + Exonic
1164933797 19:32195856-32195878 TGGGGATGTGGGGATGCTGCAGG + Intergenic
1165777465 19:38413195-38413217 TCGGCATGTGGAGCAGCTGGTGG - Exonic
1166249999 19:41563460-41563482 TCGGGGTGTGGAGCAGCTCTAGG + Intronic
1166318825 19:42003804-42003826 TGGGGGTGAGGAGAGGCTGCAGG - Intronic
1166509589 19:43395903-43395925 TCAGGAGGTGGAGAAGCTGAAGG - Intergenic
1167784717 19:51627627-51627649 GCGGCTTGAGGAGAAGCCGCTGG - Exonic
925059526 2:880412-880434 TCGGGCTGGGGAGAGACTGCAGG - Intergenic
925284387 2:2706279-2706301 TCCGCTTGTGGAAAACCTGCAGG + Intergenic
930386098 2:50697082-50697104 TCTGGTTGTTGAGAGGTTGCAGG - Intronic
932563361 2:72890941-72890963 TCGGGATGTGTAGATGCTGAAGG + Intronic
935559652 2:104547182-104547204 TCTAGTTGTGGAGAACCGGCAGG - Intergenic
937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG + Intergenic
937276078 2:120685150-120685172 TGGGCTGGTGGAGAGGCTGCAGG + Intergenic
937598167 2:123695322-123695344 CCAAGTTGTGGAGAAGCTGCAGG + Intergenic
940136126 2:150437443-150437465 TCTGTTTGTGGAGAAGTTGATGG + Intergenic
942537744 2:176983133-176983155 TCTGTCTGTGGAGAAGCTGCTGG + Intergenic
945344566 2:208697650-208697672 TTGGGCTGTGAAGAAGCTGTTGG - Intronic
946340345 2:219062537-219062559 GCGGGGTGGGGAGAAGGTGCGGG - Intergenic
947760976 2:232603639-232603661 TCGTTTTGTGGAGAGGCTGGTGG + Intergenic
1169268549 20:4182199-4182221 GCGGGTTGTGGAGCTGCTGGCGG + Exonic
1169966108 20:11219179-11219201 TTGTGTGGTGGAGAAGCTTCAGG + Intergenic
1175367488 20:58466288-58466310 CCGGGGTGTGGGGAGGCTGCAGG - Intronic
1176139208 20:63537776-63537798 ACGGGTGGAGGGGAAGCTGCCGG - Intergenic
1176658843 21:9614461-9614483 CCGGGGTGTGGAGGAGCAGCTGG + Intergenic
1177029877 21:15969064-15969086 TCTGGTTGGGGAGAAGTTGGGGG + Intergenic
1180241427 21:46509291-46509313 TCAGGGTGTTCAGAAGCTGCTGG - Exonic
1180870315 22:19142840-19142862 TCCTGATGTGGAGAAGCTCCAGG - Exonic
1181033484 22:20159122-20159144 TTGGGTTGTGGGGAAGCAGAAGG - Intergenic
1181068788 22:20320029-20320051 TCGGGATGTCGTGAAGCTGGGGG - Exonic
1185121692 22:48975192-48975214 AGGGGCTGTGCAGAAGCTGCTGG + Intergenic
1185336481 22:50272866-50272888 TGGGGCTGGGGAGAGGCTGCAGG - Intergenic
1185372026 22:50465388-50465410 TTGGGGTGTGGAGAAGCTCCTGG - Intronic
950409951 3:12829594-12829616 TCTGGGTGTGGAGAAGCTTTTGG - Intronic
951815798 3:26752926-26752948 TCAGGATCTGGAGGAGCTGCAGG + Intergenic
954187784 3:48932201-48932223 TAGTGTGGTGGGGAAGCTGCTGG + Intronic
954601473 3:51874020-51874042 GCAGGTGCTGGAGAAGCTGCTGG - Exonic
954705367 3:52477621-52477643 GCTGGTTGTGGACAATCTGCAGG + Exonic
955798011 3:62657980-62658002 TGGGCTTCTGGATAAGCTGCAGG + Intronic
961418020 3:126775773-126775795 GCGGGTTTTGGAAAAACTGCAGG + Intronic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
968506837 4:974631-974653 TCTGTTTGTCCAGAAGCTGCTGG + Intronic
969225759 4:5797298-5797320 TCGGGTTCTGGCAAACCTGCTGG - Intronic
971954657 4:33400717-33400739 CCGGGCTCTGGGGAAGCTGCAGG - Intergenic
976600876 4:86936067-86936089 GCTGGTGGTGGAGAAGCTCCGGG - Intronic
978868229 4:113542176-113542198 TCAGGCAGTGGAGAAGCTGTGGG - Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
981128283 4:141132112-141132134 TTGGGTAGGGGAGAGGCTGCCGG - Intronic
982130925 4:152227990-152228012 TCTGGCTGTGTAGAAGCTGAGGG - Intergenic
982171510 4:152666111-152666133 TCAGGTTGTGCTGATGCTGCTGG + Intronic
984450679 4:179897296-179897318 TTTGGGTGTGGAGGAGCTGCTGG + Intergenic
985810394 5:2079181-2079203 TCGCCTTGTGAAGAAGGTGCTGG + Intergenic
989726586 5:44594643-44594665 TGGGATTCTGGAAAAGCTGCAGG + Intergenic
989934343 5:50000932-50000954 ACTGTTTGTGGAGAATCTGCAGG + Intergenic
990356764 5:54975425-54975447 TCAGGTGGTGCAGATGCTGCTGG - Intergenic
990598337 5:57333019-57333041 TGGGGTTGAAGAGAAGGTGCAGG + Intergenic
992225891 5:74619439-74619461 TGAGGTTGTGTAGATGCTGCTGG - Intergenic
993958247 5:94263820-94263842 TCCGGAGGTGGAGATGCTGCAGG - Intronic
998404995 5:141869276-141869298 TCGGGTAGTGTACAAGGTGCCGG - Exonic
999174418 5:149621843-149621865 GCGGGTGGAAGAGAAGCTGCTGG + Exonic
999232283 5:150068752-150068774 AAGGCATGTGGAGAAGCTGCAGG - Intronic
1000626609 5:163546549-163546571 TGGGGTTGGGGAGAAGCTTCTGG - Intergenic
1001233870 5:170013201-170013223 TAGGGTTGGGGAGAGGCTGCTGG + Intronic
1001234001 5:170014151-170014173 TGGGGTTGGGGAGAGGCTGCTGG + Intronic
1004056897 6:12148281-12148303 TCGGGGTGTGAAGAGGATGCAGG - Intronic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1005308074 6:24532976-24532998 TCTGGTTGTGCAGAAGCTGGAGG + Intronic
1005824939 6:29627194-29627216 TCGGGGTTTGGAGAAACTGGTGG - Intronic
1005832948 6:29685637-29685659 TAGGGAGTTGGAGAAGCTGCTGG - Intergenic
1007405618 6:41634582-41634604 GTGGGGTGAGGAGAAGCTGCTGG - Intergenic
1015878950 6:137851808-137851830 TCGGGTGGGGCTGAAGCTGCAGG - Intergenic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1019658888 7:2212662-2212684 TCGGCTTCTGGTGAAGCCGCAGG - Intronic
1019873236 7:3786861-3786883 TGGGGGTGTGGGGGAGCTGCAGG - Intronic
1021973249 7:25985241-25985263 TGGTGCTGTGGAAAAGCTGCTGG - Intergenic
1023312127 7:38898293-38898315 CCAGGGTGTGGAGAAGTTGCAGG - Intronic
1026061690 7:67032286-67032308 TAGGGTTTGGGAGCAGCTGCGGG + Intronic
1028972164 7:96871349-96871371 TCAGGTTGTGGAGTTCCTGCTGG - Intergenic
1029243772 7:99183664-99183686 TGGGGTTGAGGAGAAGCTACTGG - Intronic
1029342122 7:99953720-99953742 ATGGGGTGTGGAGAAGTTGCTGG - Intergenic
1033094410 7:138417853-138417875 AAAGGTTGTGGAGAAGCAGCTGG + Intergenic
1035451253 7:158978354-158978376 TCGGGATGTGGAGAAACTGGAGG - Intergenic
1036835828 8:12065283-12065305 TCTGGTTGTGGAGAAGCATATGG + Intronic
1038767570 8:30443126-30443148 TCGGGTTGTGGAGAAGCTGCAGG - Intronic
1039799930 8:40945176-40945198 TCAGGTGAAGGAGAAGCTGCTGG - Intergenic
1041354326 8:56984241-56984263 TCGGGTTAGGGAGAAACAGCAGG + Intronic
1049560992 8:143310177-143310199 GCGGCTCCTGGAGAAGCTGCAGG - Exonic
1050399120 9:5231896-5231918 GGGGGTAGAGGAGAAGCTGCAGG + Intronic
1052883223 9:33618548-33618570 TGGGGTGGAGGAGCAGCTGCAGG - Intergenic
1053158910 9:35800120-35800142 TCGAATTGTGGAAAAGATGCAGG + Exonic
1056511025 9:87305851-87305873 TTGGGTTGTTTAGAAGCTGGAGG - Intergenic
1060015672 9:120084362-120084384 TTTGGTCGTGGACAAGCTGCTGG - Intergenic
1062292686 9:135804133-135804155 TCCATTTATGGAGAAGCTGCAGG - Intergenic
1062494214 9:136824015-136824037 TCTGGTGGTGGAGAAGATGTCGG - Intronic
1203636589 Un_KI270750v1:118068-118090 CCGGGGTGTGGAGGAGCAGCTGG + Intergenic
1190105920 X:47561274-47561296 TCGGTTTCTGGAGCGGCTGCCGG + Intronic
1190745751 X:53321051-53321073 TCGGGCCGTGGAGTACCTGCTGG - Exonic
1194019588 X:88670295-88670317 TCAGGTTCTGGAGAAGCCTCAGG + Intergenic
1196703488 X:118696809-118696831 TTGGGTTGGGGGGATGCTGCCGG + Intergenic
1200136622 X:153878359-153878381 GAGGGTGGTGGAGAAGCAGCAGG + Intronic
1202068010 Y:20960554-20960576 GCAGGTGGTGGAGAAGTTGCTGG + Intergenic